ID: 986370996

View in Genome Browser
Species Human (GRCh38)
Location 5:7079870-7079892
Sequence CTGGAGAATACACCTTCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986370992_986370996 3 Left 986370992 5:7079844-7079866 CCTTTCCCTTCAAAAGAATTCGC No data
Right 986370996 5:7079870-7079892 CTGGAGAATACACCTTCTGTAGG No data
986370993_986370996 -2 Left 986370993 5:7079849-7079871 CCCTTCAAAAGAATTCGCTCACT No data
Right 986370996 5:7079870-7079892 CTGGAGAATACACCTTCTGTAGG No data
986370994_986370996 -3 Left 986370994 5:7079850-7079872 CCTTCAAAAGAATTCGCTCACTG No data
Right 986370996 5:7079870-7079892 CTGGAGAATACACCTTCTGTAGG No data
986370991_986370996 4 Left 986370991 5:7079843-7079865 CCCTTTCCCTTCAAAAGAATTCG No data
Right 986370996 5:7079870-7079892 CTGGAGAATACACCTTCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986370996 Original CRISPR CTGGAGAATACACCTTCTGT AGG Intergenic
No off target data available for this crispr