ID: 986376405

View in Genome Browser
Species Human (GRCh38)
Location 5:7136469-7136491
Sequence GTCACCAGTGCTTTGTAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986376405_986376410 -10 Left 986376405 5:7136469-7136491 CCCCATTACAAAGCACTGGTGAC No data
Right 986376410 5:7136482-7136504 CACTGGTGACTTGGAATCCAGGG No data
986376405_986376414 29 Left 986376405 5:7136469-7136491 CCCCATTACAAAGCACTGGTGAC No data
Right 986376414 5:7136521-7136543 GCTGATCACTAGCCACCAGCAGG No data
986376405_986376412 7 Left 986376405 5:7136469-7136491 CCCCATTACAAAGCACTGGTGAC No data
Right 986376412 5:7136499-7136521 CCAGGGTGATTCAAAAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986376405 Original CRISPR GTCACCAGTGCTTTGTAATG GGG (reversed) Intergenic
No off target data available for this crispr