ID: 986378227

View in Genome Browser
Species Human (GRCh38)
Location 5:7155493-7155515
Sequence CTGGCTCCACAGAGTGAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986378224_986378227 6 Left 986378224 5:7155464-7155486 CCTTGTCTAGCTTTGGTATCAAG No data
Right 986378227 5:7155493-7155515 CTGGCTCCACAGAGTGAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986378227 Original CRISPR CTGGCTCCACAGAGTGAATT AGG Intergenic
No off target data available for this crispr