ID: 986389588

View in Genome Browser
Species Human (GRCh38)
Location 5:7272181-7272203
Sequence TCTCCTAGTTTGCCATGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986389588_986389589 15 Left 986389588 5:7272181-7272203 CCATTTCATGGCAAACTAGGAGA No data
Right 986389589 5:7272219-7272241 AGATCTTATCAGACTTACAGAGG No data
986389588_986389590 19 Left 986389588 5:7272181-7272203 CCATTTCATGGCAAACTAGGAGA No data
Right 986389590 5:7272223-7272245 CTTATCAGACTTACAGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986389588 Original CRISPR TCTCCTAGTTTGCCATGAAA TGG (reversed) Intergenic
No off target data available for this crispr