ID: 986392314

View in Genome Browser
Species Human (GRCh38)
Location 5:7298136-7298158
Sequence GAGTCGTATTTCTGAAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986392308_986392314 -3 Left 986392308 5:7298116-7298138 CCACCAGTCCCCACTCCTGGGAG No data
Right 986392314 5:7298136-7298158 GAGTCGTATTTCTGAAAGCTTGG No data
986392309_986392314 -6 Left 986392309 5:7298119-7298141 CCAGTCCCCACTCCTGGGAGTCG No data
Right 986392314 5:7298136-7298158 GAGTCGTATTTCTGAAAGCTTGG No data
986392305_986392314 19 Left 986392305 5:7298094-7298116 CCAGGAGGAGGAGGGGATGCAGC No data
Right 986392314 5:7298136-7298158 GAGTCGTATTTCTGAAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986392314 Original CRISPR GAGTCGTATTTCTGAAAGCT TGG Intergenic
No off target data available for this crispr