ID: 986394882

View in Genome Browser
Species Human (GRCh38)
Location 5:7319086-7319108
Sequence GTGGCAGTGCTAAAGCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986394882_986394886 20 Left 986394882 5:7319086-7319108 CCACCATGCTTTAGCACTGCCAC No data
Right 986394886 5:7319129-7319151 AACCCTGAGAGCACAGATAGTGG No data
986394882_986394887 21 Left 986394882 5:7319086-7319108 CCACCATGCTTTAGCACTGCCAC No data
Right 986394887 5:7319130-7319152 ACCCTGAGAGCACAGATAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986394882 Original CRISPR GTGGCAGTGCTAAAGCATGG TGG (reversed) Intergenic
No off target data available for this crispr