ID: 986397408

View in Genome Browser
Species Human (GRCh38)
Location 5:7344306-7344328
Sequence TAAGAGACCTGTCCCTGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986397408_986397413 3 Left 986397408 5:7344306-7344328 CCTCCTCAGGGACAGGTCTCTTA No data
Right 986397413 5:7344332-7344354 AATCTGCAGGGCACCTGTTAAGG No data
986397408_986397410 -10 Left 986397408 5:7344306-7344328 CCTCCTCAGGGACAGGTCTCTTA No data
Right 986397410 5:7344319-7344341 AGGTCTCTTAACCAATCTGCAGG No data
986397408_986397415 27 Left 986397408 5:7344306-7344328 CCTCCTCAGGGACAGGTCTCTTA No data
Right 986397415 5:7344356-7344378 TTGAAGTGTGTCCCTTACAAAGG No data
986397408_986397411 -9 Left 986397408 5:7344306-7344328 CCTCCTCAGGGACAGGTCTCTTA No data
Right 986397411 5:7344320-7344342 GGTCTCTTAACCAATCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986397408 Original CRISPR TAAGAGACCTGTCCCTGAGG AGG (reversed) Intergenic
No off target data available for this crispr