ID: 986399013

View in Genome Browser
Species Human (GRCh38)
Location 5:7361349-7361371
Sequence GTTTCTTTGATGAAGGTAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986399013_986399016 20 Left 986399013 5:7361349-7361371 CCGACTACCTTCATCAAAGAAAC No data
Right 986399016 5:7361392-7361414 CACTGAAGAAAGGAAAATGTTGG No data
986399013_986399015 10 Left 986399013 5:7361349-7361371 CCGACTACCTTCATCAAAGAAAC No data
Right 986399015 5:7361382-7361404 TTCACTGAATCACTGAAGAAAGG No data
986399013_986399017 21 Left 986399013 5:7361349-7361371 CCGACTACCTTCATCAAAGAAAC No data
Right 986399017 5:7361393-7361415 ACTGAAGAAAGGAAAATGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986399013 Original CRISPR GTTTCTTTGATGAAGGTAGT CGG (reversed) Intergenic
No off target data available for this crispr