ID: 986399015

View in Genome Browser
Species Human (GRCh38)
Location 5:7361382-7361404
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986399014_986399015 3 Left 986399014 5:7361356-7361378 CCTTCATCAAAGAAACACATACA No data
Right 986399015 5:7361382-7361404 TTCACTGAATCACTGAAGAAAGG No data
986399013_986399015 10 Left 986399013 5:7361349-7361371 CCGACTACCTTCATCAAAGAAAC No data
Right 986399015 5:7361382-7361404 TTCACTGAATCACTGAAGAAAGG No data
986399012_986399015 11 Left 986399012 5:7361348-7361370 CCCGACTACCTTCATCAAAGAAA No data
Right 986399015 5:7361382-7361404 TTCACTGAATCACTGAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr