ID: 986399545

View in Genome Browser
Species Human (GRCh38)
Location 5:7367770-7367792
Sequence GTGCACCCTCGCCTTGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986399545_986399550 21 Left 986399545 5:7367770-7367792 CCCTCACCAAGGCGAGGGTGCAC No data
Right 986399550 5:7367814-7367836 GTAAAGAAAGCCTAGTGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986399545 Original CRISPR GTGCACCCTCGCCTTGGTGA GGG (reversed) Intergenic