ID: 986399550

View in Genome Browser
Species Human (GRCh38)
Location 5:7367814-7367836
Sequence GTAAAGAAAGCCTAGTGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986399548_986399550 15 Left 986399548 5:7367776-7367798 CCAAGGCGAGGGTGCACAGGCAC No data
Right 986399550 5:7367814-7367836 GTAAAGAAAGCCTAGTGCTTTGG No data
986399545_986399550 21 Left 986399545 5:7367770-7367792 CCCTCACCAAGGCGAGGGTGCAC No data
Right 986399550 5:7367814-7367836 GTAAAGAAAGCCTAGTGCTTTGG No data
986399546_986399550 20 Left 986399546 5:7367771-7367793 CCTCACCAAGGCGAGGGTGCACA No data
Right 986399550 5:7367814-7367836 GTAAAGAAAGCCTAGTGCTTTGG No data
986399549_986399550 -7 Left 986399549 5:7367798-7367820 CCTTCTCACATTCAGAGTAAAGA No data
Right 986399550 5:7367814-7367836 GTAAAGAAAGCCTAGTGCTTTGG No data
986399542_986399550 27 Left 986399542 5:7367764-7367786 CCATTTCCCTCACCAAGGCGAGG No data
Right 986399550 5:7367814-7367836 GTAAAGAAAGCCTAGTGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986399550 Original CRISPR GTAAAGAAAGCCTAGTGCTT TGG Intergenic