ID: 986401893

View in Genome Browser
Species Human (GRCh38)
Location 5:7390198-7390220
Sequence GTTTTTAAAGATATAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986401888_986401893 10 Left 986401888 5:7390165-7390187 CCTTGCCACTTTAAAATTTGAAA No data
Right 986401893 5:7390198-7390220 GTTTTTAAAGATATAGTGGAGGG No data
986401889_986401893 5 Left 986401889 5:7390170-7390192 CCACTTTAAAATTTGAAAACATC No data
Right 986401893 5:7390198-7390220 GTTTTTAAAGATATAGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986401893 Original CRISPR GTTTTTAAAGATATAGTGGA GGG Intergenic
No off target data available for this crispr