ID: 986404384

View in Genome Browser
Species Human (GRCh38)
Location 5:7411288-7411310
Sequence TGGCTCACCCTCTGAGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 269}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986404374_986404384 26 Left 986404374 5:7411239-7411261 CCTCACAAGCAGCAGCTGACTGT 0: 1
1: 0
2: 1
3: 17
4: 183
Right 986404384 5:7411288-7411310 TGGCTCACCCTCTGAGGTGGGGG 0: 1
1: 0
2: 2
3: 18
4: 269
986404376_986404384 -3 Left 986404376 5:7411268-7411290 CCGTTGGCCGTCAGAGCCTCTGG 0: 1
1: 0
2: 0
3: 14
4: 175
Right 986404384 5:7411288-7411310 TGGCTCACCCTCTGAGGTGGGGG 0: 1
1: 0
2: 2
3: 18
4: 269
986404378_986404384 -10 Left 986404378 5:7411275-7411297 CCGTCAGAGCCTCTGGCTCACCC 0: 1
1: 0
2: 2
3: 22
4: 290
Right 986404384 5:7411288-7411310 TGGCTCACCCTCTGAGGTGGGGG 0: 1
1: 0
2: 2
3: 18
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986404384 Original CRISPR TGGCTCACCCTCTGAGGTGG GGG Intronic
900813579 1:4826406-4826428 TGGCACACCCTCTCAGCTCGGGG - Intergenic
902711456 1:18242868-18242890 TGGCTCACACTCTGCTGGGGGGG + Intronic
904925529 1:34044656-34044678 TAGATCACCCTCGGAAGTGGAGG - Intronic
905275304 1:36813774-36813796 TAGCTCATCATCTGAGGTGGGGG + Intronic
905535494 1:38718374-38718396 TGGCTCACACCCTGGGGTTGTGG - Intergenic
906921624 1:50070625-50070647 TGGCTCACCCTTTAAGTAGGTGG - Intronic
907128509 1:52074049-52074071 TGCCTCACCCTCTGAGTAGCTGG - Intronic
907204633 1:52758083-52758105 TGCCTCACCCTCTGAGCAGCTGG - Intronic
907764773 1:57398298-57398320 TGGCTCTCCCTCTGTGCTCGAGG - Intronic
910431934 1:87167622-87167644 CGGCTCTCTCTCTGAGGGGGTGG - Intronic
912839659 1:113027811-113027833 TGGCTCACTCCCTGAGGAGGAGG + Intergenic
915380186 1:155433333-155433355 TGGGTCAGGCTCTGAGGTGTGGG + Intronic
916597494 1:166258194-166258216 TGGCTGAGCCTCAGGGGTGGAGG + Intergenic
917065012 1:171083353-171083375 TGGCTTGACCTCTGAGGTGCTGG - Intergenic
917597047 1:176539532-176539554 TGGCTCACAGTCTGGGGTGGAGG + Intronic
917817573 1:178725730-178725752 TCGCTCTCCCTCTTGGGTGGCGG + Intronic
918002327 1:180509058-180509080 TGGCTGACCTCCTGAGTTGGTGG + Intergenic
919822409 1:201481581-201481603 TGGCTCAGCCTCTGAGTGGCTGG - Intergenic
920211873 1:204334224-204334246 TGGCTCTCCCGCTGTGATGGAGG - Intronic
920689425 1:208134636-208134658 TGGCTGAGCCTCTGGGGAGGAGG - Intronic
921047888 1:211490385-211490407 TAGCTCAGCTTCAGAGGTGGAGG - Intronic
922590548 1:226772634-226772656 TGGCCCAGCCTCTTTGGTGGAGG - Intergenic
922729842 1:227943895-227943917 CGGTTGAGCCTCTGAGGTGGAGG + Intronic
923649754 1:235863306-235863328 TGGCTGAACCTGGGAGGTGGAGG + Intronic
1068918693 10:62461068-62461090 TGGGTCTCTCTCTGGGGTGGAGG - Intronic
1069579296 10:69554584-69554606 TGGGTCTCCCACAGAGGTGGGGG - Intergenic
1070247740 10:74747894-74747916 TGGCTCACCCAGTAAGGTGGTGG - Intergenic
1072110365 10:92313807-92313829 TGCCTTAGCCTGTGAGGTGGAGG + Intronic
1073440894 10:103552110-103552132 AGGCTCACCCTGTGGGGTGCAGG + Intronic
1073808630 10:107127783-107127805 TGCCTCACATTCAGAGGTGGAGG - Intronic
1073870348 10:107855932-107855954 TTTCTCACTCTCAGAGGTGGGGG + Intergenic
1075228059 10:120647452-120647474 TGGTTCATTCTCTGGGGTGGAGG + Intergenic
1076142972 10:128094201-128094223 TGCCTCAGCCTCTGAGGAGCTGG - Intergenic
1077545547 11:3167956-3167978 CGGGTCACCCTTTGTGGTGGAGG - Intergenic
1077611037 11:3643100-3643122 TGGCTGACACTCTGAGGGGATGG - Intergenic
1077892950 11:6432421-6432443 AGTCTCTCCCTATGAGGTGGTGG + Intronic
1078778518 11:14415353-14415375 TGCCTTCCCCTCTGAGGTCGGGG - Intergenic
1079989516 11:27232106-27232128 TGACTCAGGCTCTGAGCTGGAGG - Intergenic
1080857991 11:36128981-36129003 TGGCTTTCCCTGTGAGATGGAGG + Intronic
1081675757 11:44968080-44968102 TGGCTCACTCTCTGAGGAGAAGG - Intergenic
1083005005 11:59335780-59335802 TGGCTCACACTTTGACCTGGTGG - Intergenic
1083768821 11:64855108-64855130 TGACTCACCCTGCGTGGTGGGGG - Intronic
1083939460 11:65887911-65887933 GTGCTCACCCTCTGGGATGGTGG - Intronic
1084118543 11:67055949-67055971 AGCCTCACCCTCTGCGGGGGCGG + Intergenic
1084324519 11:68391954-68391976 TGCCTCACCCTCTGAGTAGCTGG + Intronic
1088658667 11:112025737-112025759 GGGCTCACCTTCTGATGCGGGGG - Exonic
1089497450 11:118914788-118914810 GGCCTCGCCCTCTGAGGTTGGGG + Intronic
1090596798 11:128329216-128329238 TGGCTCACTCTGAGGGGTGGGGG - Intergenic
1092203786 12:6603439-6603461 TGCCTCACCCACTGAGGAGAGGG + Intronic
1096005979 12:48172214-48172236 TGCCTCAGCCTCTGAGTAGGTGG - Intronic
1097115152 12:56691528-56691550 TGGCAGAACCTGTGAGGTGGAGG + Intergenic
1100814025 12:98368075-98368097 TGGCTCACCCTCTAGGGAAGGGG - Intergenic
1102053093 12:109877579-109877601 TGGCTCATTCTTTGTGGTGGTGG - Intronic
1102243957 12:111343217-111343239 TCACCCACTCTCTGAGGTGGTGG - Intronic
1103259688 12:119575828-119575850 TGACTCGCACTCTGAGGTGCTGG - Intergenic
1103277550 12:119725340-119725362 TGCTTGACCCTCGGAGGTGGAGG + Intronic
1104752327 12:131247628-131247650 TGGGTCACCCTCTCAGGGGGTGG + Intergenic
1104779607 12:131411600-131411622 TGGGTCACCCTCTCAGGGGGTGG - Intergenic
1104797161 12:131527919-131527941 TGGCTCAGCCCCTGAGGGTGTGG + Intergenic
1104898607 12:132176105-132176127 TGGCTCTGGCTCTGAGGGGGTGG - Intergenic
1105265573 13:18811061-18811083 TGGCTCAGCCTCAGAGGTTCTGG - Intergenic
1106570567 13:30923723-30923745 TGGCTCACCCTCTGTCCTGTGGG + Intronic
1106857670 13:33870568-33870590 TGGCTCACCACCTGGGGTGAAGG + Intronic
1107872312 13:44758919-44758941 TGGCTCACCCTGTGTGGCGGTGG + Intergenic
1107940497 13:45377623-45377645 TGCCTCCCCCTCTGCGATGGGGG + Intergenic
1107941468 13:45381542-45381564 TGCCTCCCCCCCTGAGATGGGGG + Intergenic
1107941755 13:45382340-45382362 TGCCTCCCCCTCTGCGATGGGGG + Intergenic
1109220321 13:59635058-59635080 TTGCTCACTCTCTGAGGGGTGGG - Intergenic
1109281543 13:60362377-60362399 TGCCTCAACCTCTGAAGTGCTGG - Intergenic
1109538338 13:63742266-63742288 TGCCTCCCCCTCTGCGATGGGGG + Intergenic
1109545501 13:63837506-63837528 TGCCTCCCCCTCTGCGATGGGGG - Intergenic
1110438588 13:75502901-75502923 TAGCCCACACTCAGAGGTGGAGG + Intergenic
1111430497 13:88143928-88143950 TGGCTCACCCACTGAGAGTGGGG - Intergenic
1114265928 14:21072579-21072601 GGGCTCCCCATCTTAGGTGGAGG - Intronic
1118733398 14:68685018-68685040 TGGCTCACCATCTGAGGAGCTGG - Intronic
1119134097 14:72201054-72201076 TTGCTCACCCTCTGAGGATTAGG + Intronic
1119244127 14:73089025-73089047 TGCCTCAGCCTCTGAGTTGCTGG - Intronic
1119548588 14:75491741-75491763 TGGAAAACCCTCTGAGGTTGAGG + Intergenic
1120158966 14:81125561-81125583 TGGATCTCCCTCTGAGGGGAGGG + Intronic
1120907383 14:89632433-89632455 GGGCCCACACTCTCAGGTGGGGG + Intronic
1121694278 14:95900225-95900247 TGTCTCTCCCTCTGAGTTGCAGG - Intergenic
1122816626 14:104317157-104317179 TGGGGCACTCTCTGGGGTGGGGG - Intergenic
1124200253 15:27673310-27673332 TCTCTTCCCCTCTGAGGTGGAGG - Intergenic
1125537664 15:40451683-40451705 TGGGTCTCCCTCTGCTGTGGGGG + Intronic
1127066594 15:55246275-55246297 TTGGTCACCCACTGAGGTGATGG - Intronic
1128789538 15:70423016-70423038 TGTCTGCCCCTCTGATGTGGAGG - Intergenic
1129597267 15:76974680-76974702 GGGCTGACCCTCTGATGGGGTGG + Intergenic
1132034308 15:98468411-98468433 TGCCTCACCCTCTGAGTAGCTGG + Intronic
1132464352 16:70965-70987 TGGCACAGACACTGAGGTGGGGG + Intronic
1134647216 16:15878746-15878768 TGCCTCAGCCTCTGAAGTGCTGG + Intronic
1136121325 16:28137118-28137140 TCGTGCACCCTCAGAGGTGGAGG + Intronic
1138110886 16:54322932-54322954 TGCCTCAGCCTCTGAGTAGGTGG + Intergenic
1139517849 16:67462268-67462290 AGCCTCACCCTGGGAGGTGGGGG + Intronic
1141496403 16:84413421-84413443 TGACTCACCCTCTGTGATGTGGG - Intronic
1141660959 16:85441167-85441189 TGGCTCCTCCTTTGTGGTGGGGG + Intergenic
1142015523 16:87744329-87744351 TGCTTGAACCTCTGAGGTGGAGG + Intronic
1142541468 17:662955-662977 TGCCTCAGCCTCTGAAGTGCTGG - Intronic
1142756119 17:2017410-2017432 TGGCTCGCCCTCACAGGGGGTGG - Intronic
1143409630 17:6701144-6701166 CAGCTCAGCATCTGAGGTGGGGG - Intronic
1143495141 17:7308200-7308222 TGGCGCAGTCTCTGAGGAGGGGG + Intronic
1144772789 17:17769240-17769262 TGGGTCACCCTCAGGGCTGGAGG + Intronic
1145270689 17:21403194-21403216 TGGCTGAGGCTCTGAGGTGTGGG + Intronic
1146859782 17:36286819-36286841 TGCCTCAGCCTCTCAGGTAGGGG - Intronic
1147090107 17:38090906-38090928 TGCCTCAGCCTCTCAGGTAGGGG - Intergenic
1147107105 17:38229615-38229637 TGCCTCAGCCTCTCAGGTAGGGG + Intergenic
1147784719 17:42971047-42971069 TGCCTCACCCTCCCAAGTGGTGG - Intronic
1148090385 17:45019579-45019601 AGGCTCACACTCCGCGGTGGAGG - Intergenic
1148422419 17:47558918-47558940 TGCCTCAGCCTCTCAGGTAGGGG - Intronic
1148855055 17:50574506-50574528 GGCCTCACCCCTTGAGGTGGTGG - Intronic
1148901297 17:50879982-50880004 TGCCTGAACCTGTGAGGTGGAGG - Intergenic
1148903512 17:50896568-50896590 TGGCTCACCCTGGGAGGCCGAGG + Intergenic
1150421973 17:65044957-65044979 TGGCTGAGCCTGGGAGGTGGAGG + Intronic
1151265332 17:72950956-72950978 TGGCTCATTCTCTGTTGTGGGGG - Intronic
1153940235 18:9970450-9970472 TTTCTCACCCTCTGAGGAGTTGG + Intergenic
1154422824 18:14250467-14250489 TGGCTCAGCCTCAGAGGTTCTGG + Intergenic
1156109532 18:33708564-33708586 TGGATAATCCTCTGTGGTGGGGG + Intronic
1156385313 18:36599204-36599226 TGCCTCACCCTCTGTGGGAGAGG - Intronic
1157362711 18:47034160-47034182 GAGCTCCCTCTCTGAGGTGGAGG - Exonic
1157550117 18:48575617-48575639 TCCCTCACCCTCTGAGGGGATGG + Intronic
1158349857 18:56554136-56554158 TGGCACACCCACAGAGGTGAAGG - Intergenic
1158650007 18:59275827-59275849 TGGCTGACGTGCTGAGGTGGTGG + Intronic
1160246738 18:77165527-77165549 TGGGTCACCCTATGAGGCTGGGG + Intergenic
1160593398 18:79957776-79957798 TGCCTCAGCCTCTCAGGTGCTGG + Intergenic
1160817780 19:1044049-1044071 TGTCTCACCCTCTGAGTAGCTGG + Intronic
1162726056 19:12690227-12690249 TGGGTCACTCTGTGGGGTGGGGG - Intronic
1163831809 19:19550607-19550629 TGGCGGGGCCTCTGAGGTGGGGG + Intergenic
1164930398 19:32170775-32170797 TGGCTCACCCGTGGGGGTGGAGG + Intergenic
1165039546 19:33059380-33059402 TGCCTGAACCTGTGAGGTGGAGG - Intronic
1165850955 19:38850030-38850052 TGGCTCCCCCTATCGGGTGGGGG - Exonic
1166154706 19:40902211-40902233 TGTTTCACTCTCTGAGATGGTGG + Intergenic
1167116365 19:47491396-47491418 TGGCTCACGGCCTGGGGTGGTGG - Intronic
1167149222 19:47699291-47699313 GGGCTCACCCTCTGGGGTGGGGG - Exonic
1167492054 19:49798734-49798756 TGGCACACCTGCTGGGGTGGTGG - Intronic
1167700805 19:51044235-51044257 TGCCTCAGCCTCTGAGTAGGTGG + Intergenic
1167899250 19:52606225-52606247 AGCCTCAGCCTCTGAGGTAGCGG - Intronic
1168507755 19:56950692-56950714 ATGCTCACACTCTGAGGTGCTGG - Intergenic
927349129 2:22086049-22086071 TGCCTGAACCTGTGAGGTGGAGG + Intergenic
928595751 2:32857430-32857452 GTGCTCACCCTCTGGGGGGGTGG - Intergenic
931703634 2:64928440-64928462 TGGATCAACCTCTGAGTTCGTGG - Intergenic
934477147 2:94601419-94601441 TGGCTCCCCCACAGAGGTGACGG + Intronic
934868041 2:97831751-97831773 TGCCTGAACCTCAGAGGTGGAGG - Intronic
936573984 2:113638288-113638310 GGGCTCGCCCTGTGTGGTGGCGG - Intronic
937285739 2:120750068-120750090 TGCCTCATCCTCTGAGGGGAGGG + Intronic
938422616 2:131156589-131156611 TGGGGCACCCTGTGAGGTGGGGG + Intronic
939497049 2:142936814-142936836 TGGCCTACTCTCTGGGGTGGAGG + Intronic
944108051 2:196100837-196100859 TGGCTCAAACTAGGAGGTGGAGG + Intergenic
944159484 2:196643266-196643288 TGGCCCAGCCTCTGAGGGGAAGG - Intronic
946818986 2:223610801-223610823 TGCCTCAGCCTCTCAGGTGGTGG - Intergenic
947643441 2:231720758-231720780 TGGTTCCCCCTCAGAGATGGCGG - Intergenic
947765766 2:232636099-232636121 TGGCTCATCCTTGGTGGTGGTGG + Intronic
948196269 2:236099032-236099054 TGGCTCCCCCGCTGGGGAGGTGG - Intronic
1169004265 20:2193716-2193738 TTGCTTGCCCTCTGAGGTTGGGG - Intergenic
1171021316 20:21586760-21586782 TGGCTCACCCTGTGAGCTTGTGG + Intergenic
1173951943 20:47000406-47000428 TGCCTCAGCCTCTGCGCTGGAGG - Intronic
1174917466 20:54668663-54668685 TGGCTCATTCTCTGCGGCGGGGG + Intergenic
1175233252 20:57489701-57489723 TGCCTCAGCCTCTGAGGAGCAGG + Intergenic
1176850641 21:13909492-13909514 TGGCTCAGCCTCAGAGGTTCTGG - Intergenic
1179791364 21:43757682-43757704 TGACTCACTGGCTGAGGTGGGGG - Exonic
1180087894 21:45516231-45516253 AGGGTCAGCCTCTGAGCTGGAGG - Intronic
1180299729 22:11027287-11027309 TGTTTCAACCTGTGAGGTGGAGG + Intergenic
1181019970 22:20094600-20094622 TCGCTCAGCCTCTGAGCTGTGGG + Intronic
1181535527 22:23540948-23540970 TGGCTGACTCCCTGAAGTGGTGG - Intergenic
1182899380 22:33885302-33885324 TAGCTGACCCTCTGCGGAGGGGG + Intronic
1183175280 22:36219465-36219487 TGCCTCACCCTCTGAGTAGCTGG - Intergenic
1183826857 22:40395403-40395425 TGGTTCAGCCTGGGAGGTGGAGG - Intronic
1184348799 22:43929678-43929700 TGCCTGAACCTGTGAGGTGGAGG - Intronic
1184979409 22:48085372-48085394 TGGCTTCCCAGCTGAGGTGGCGG - Intergenic
1185426190 22:50772605-50772627 GGGCTCGCCCTGTGTGGTGGCGG + Intronic
950760060 3:15214602-15214624 TGCCTCAACCTCTGAGGAGCTGG - Intronic
953569252 3:44058223-44058245 TGGCTGTCCTTCTGAGGAGGAGG + Intergenic
954502200 3:51029335-51029357 TTGCTCACCCTCTGCGGGGCTGG + Intronic
954761439 3:52877538-52877560 TGGCTCAGCCTCTGACCTGCTGG + Intronic
954846939 3:53567547-53567569 AGGCTCACCCTCTGGTGAGGTGG - Intronic
954897730 3:53991229-53991251 TGCCTCAACCTGGGAGGTGGAGG - Intergenic
956264547 3:67382304-67382326 TGGCTCAGCCTCTGACTTGCTGG - Intronic
959070208 3:101694934-101694956 TGGCTGACTCCCTGAAGTGGTGG - Intergenic
961011714 3:123440773-123440795 TGGCTCACCTTTTGAGGGGGAGG - Intronic
962887711 3:139642766-139642788 TTCCTCACCCTCTGAAGAGGGGG - Intronic
965258313 3:166445003-166445025 TGGCTCACCCTCAGTGGACGTGG + Intergenic
967906951 3:194509365-194509387 TGCTTCAGCCTCGGAGGTGGAGG - Intergenic
968234514 3:197023801-197023823 AGCCTCACCCTCTCAGCTGGTGG - Intronic
968425122 4:518128-518150 GCTCTCACCCTGTGAGGTGGAGG + Intronic
968818230 4:2832648-2832670 GGGCTCATGCTCTGGGGTGGCGG + Intronic
969362987 4:6676996-6677018 GAGCTGACCATCTGAGGTGGTGG + Intergenic
969519675 4:7668746-7668768 TGTCTGTCCCTCTGAGGTGAGGG + Intronic
969733158 4:8969158-8969180 TGCCTCACCCCCTGCGATGGGGG - Intergenic
969792734 4:9503236-9503258 TGCCTCACCCCCTGCGATGGGGG - Intergenic
970418021 4:15878355-15878377 TGACTCAGCTTCTGAGGTGTGGG + Intergenic
974949410 4:68569999-68570021 TGGCTTGCTCTCTGGGGTGGAGG - Intronic
975415452 4:74099312-74099334 TGGCCCCGCCTCTGGGGTGGAGG + Intergenic
979145050 4:117236046-117236068 TGCCTCAGCCTCTGAAGTGCTGG - Intergenic
982612188 4:157588916-157588938 TAGATCAGCCTCTAAGGTGGAGG + Intergenic
982721807 4:158867809-158867831 TGGCTGACCCACTGAGCTGCAGG + Intronic
984195149 4:176650169-176650191 TGGGTCACCTTCTGAGGTACTGG + Intergenic
984928369 4:184826039-184826061 TGGCTCAGCCGCGGCGGTGGCGG - Intronic
985363881 4:189205822-189205844 TGCCTCAGCCTCTGAAGTAGTGG - Intergenic
985390809 4:189490581-189490603 TGGCTGACCCTCGGTGGTGTGGG + Intergenic
985390830 4:189490671-189490693 TGGCTGACCCTCGGTGGTGTAGG + Intergenic
985390861 4:189490791-189490813 TGGCTGACCCTCGGTGGTGTAGG + Intergenic
985390895 4:189490911-189490933 TGGCTGACCCTCGGTGGTGTGGG + Intergenic
985390904 4:189490941-189490963 TGGCTGACCCTCGGTGGTGTGGG + Intergenic
985390988 4:189491271-189491293 TGGCTGACCCTCGGTGGTGTGGG + Intergenic
985391035 4:189491451-189491473 TGGCTGACCCTCGGTGGTGTGGG + Intergenic
985391052 4:189491511-189491533 TGGCTGACCCTCGGTGGTGTGGG + Intergenic
985391069 4:189491571-189491593 TGGCTGACCCTCGGTGGTGTGGG + Intergenic
985391086 4:189491631-189491653 TGGCTGACCCTCGGTGGTGTGGG + Intergenic
985391132 4:189491811-189491833 TGGCTGACCCTCGGTGGTGTGGG + Intergenic
985391149 4:189491871-189491893 TGGCTGACCCTCGGTGGTGTGGG + Intergenic
985391157 4:189491901-189491923 TGGCTCACCCTCACTGGTGTGGG + Intergenic
985391174 4:189491961-189491983 TGGCTGACCCTCGGTGGTGTGGG + Intergenic
985624621 5:978687-978709 TGGCTCATGCTCTGGGGAGGAGG + Intergenic
985857493 5:2441635-2441657 TGACGCACCCTCTGAGGTCAGGG - Intergenic
986404384 5:7411288-7411310 TGGCTCACCCTCTGAGGTGGGGG + Intronic
986692702 5:10326834-10326856 TGCCTCAGCCTCTGAGTAGGTGG - Intergenic
988636296 5:32988337-32988359 TGCCTCACCCTATGAGATAGAGG - Intergenic
990690349 5:58356706-58356728 TGCCTGAGCCTCTGAGGTGGTGG - Intergenic
991488058 5:67158455-67158477 TGCCTCACCCTCTGAGTAGCTGG - Intronic
992252226 5:74886839-74886861 TGCTTCAACCTCAGAGGTGGAGG - Intergenic
992300037 5:75368643-75368665 TGTTTCATCCTCTGAGCTGGAGG + Intronic
992301888 5:75391077-75391099 TGCCTCAGCCTCTGAGTAGGTGG + Intronic
994858058 5:105151393-105151415 TGGTTGAACCTCAGAGGTGGAGG - Intergenic
995652586 5:114386641-114386663 TGGCTCAACCTTTCAGATGGTGG - Intronic
997452940 5:133997981-133998003 TGCCTCAACCTGGGAGGTGGAGG + Intronic
998476841 5:142429122-142429144 CGTCACACCCTCTGAAGTGGCGG - Intergenic
999584742 5:153077545-153077567 TGTCACACCCTCTGAGGTCTTGG - Intergenic
1000179304 5:158792372-158792394 TGGATCACCCCCTGAGGGGTGGG - Intronic
1000945628 5:167419375-167419397 TGGCTGAGCCTGGGAGGTGGAGG + Intronic
1001419859 5:171578335-171578357 TGGCTCACCCTCCCAGAGGGTGG + Intergenic
1003014511 6:2457283-2457305 TGCCTGAACCTCGGAGGTGGAGG - Intergenic
1003361414 6:5429694-5429716 TGGCTCAGCCTCTGAGTAGCTGG - Intronic
1004341649 6:14813126-14813148 TGGCCCACTCTTTGAGATGGGGG - Intergenic
1004668924 6:17777216-17777238 TGTCGCAGCCTCTGGGGTGGGGG - Intronic
1005224976 6:23632188-23632210 TGGCTGTCCCTCTGTGGGGGTGG + Intergenic
1006444224 6:34069857-34069879 TGGCTGAGCAGCTGAGGTGGGGG - Intronic
1006472252 6:34235700-34235722 CGGCTCGCCCCCTGAGGAGGGGG + Intergenic
1007207598 6:40165184-40165206 TGGCTCACTGGCTGAGGAGGTGG - Intergenic
1007572079 6:42900125-42900147 TGGCTGACTCCCTGAAGTGGTGG + Intergenic
1011505507 6:88037795-88037817 TGGCACACTCTCTGAGTTGAAGG + Intergenic
1011739785 6:90348257-90348279 AGGATCACCCTCTGCAGTGGAGG + Intergenic
1011743749 6:90389006-90389028 TGGCACACCCTCTTATGTTGGGG + Intergenic
1018768775 6:166954875-166954897 TGCCTCAGCCTCTGAGTAGGTGG - Intronic
1018873745 6:167802650-167802672 GGGCTCAGCCTCTTTGGTGGTGG + Intergenic
1019543162 7:1560464-1560486 GGGCCCAGCCTCTGAGGTGGCGG + Intronic
1024150632 7:46568393-46568415 TTGAACACCCTCTGGGGTGGGGG + Intergenic
1024169237 7:46766971-46766993 TGGATGTCCCCCTGAGGTGGGGG + Intergenic
1025097669 7:56109368-56109390 TGCTTCAACCTGTGAGGTGGAGG - Intergenic
1027012851 7:74761459-74761481 TGCCTGAACCTGTGAGGTGGAGG - Intergenic
1030320963 7:108166874-108166896 TGGCTCCCGCTCAGAGGTGGAGG - Intronic
1033911139 7:146264335-146264357 TGTCTCAGCCTCTGAGGAGCTGG - Intronic
1035663942 8:1366448-1366470 TGGGTCCCCATCTGAAGTGGGGG + Intergenic
1036262677 8:7253119-7253141 TGCCTCACCCCCTGCGATGGGGG + Intergenic
1036303908 8:7586439-7586461 TGCCTCACCCCCTGCGATGGGGG - Intergenic
1036314717 8:7711658-7711680 TGCCTCACCCCCTGCGATGGGGG + Intergenic
1036354763 8:8034431-8034453 TGCCTCACCCCCTGCGATGGGGG - Intergenic
1036509021 8:9383333-9383355 TGGCTCTGCCTCTGGGGTGAAGG + Intergenic
1040981884 8:53252509-53252531 GGGCTCAGCCCCTGAGGTGAAGG + Intergenic
1041212169 8:55563509-55563531 TGTCTCACCTACTGGGGTGGTGG - Intergenic
1047597543 8:126394084-126394106 TTGCTCACACTCAGAGGTGGTGG + Intergenic
1048001877 8:130385495-130385517 TGGCTCAGCGCCCGAGGTGGGGG + Intronic
1048319557 8:133387806-133387828 ATGCTCTCCCTCTGGGGTGGGGG + Intergenic
1048447682 8:134504228-134504250 GGTGTCAGCCTCTGAGGTGGGGG - Intronic
1049813752 8:144588449-144588471 TGCCTCACCCTATGGGGAGGTGG + Intronic
1049814744 8:144592929-144592951 ATGCTGACCCTCTGTGGTGGAGG - Intronic
1051367971 9:16334538-16334560 TTGCTCACCCTATAAGGAGGGGG + Intergenic
1051734645 9:20186082-20186104 TAGCTCACTTTCTGAGGAGGGGG + Intergenic
1051799119 9:20911385-20911407 TTGCTCACCCTGTGAGGTCAAGG - Intronic
1052085081 9:24255236-24255258 TAGCTCAACCTCTGAAATGGAGG - Intergenic
1052158512 9:25226154-25226176 TGGCTCACCCTCAGTGGGCGTGG - Intergenic
1052658372 9:31395369-31395391 TGCCTCAGCCTCTGAAGTAGTGG - Intergenic
1056701838 9:88917664-88917686 CGGCTCACCTTCTGGAGTGGTGG - Intergenic
1057244314 9:93441197-93441219 TGTCTCCCCTTCTGTGGTGGTGG - Intergenic
1058061163 9:100497553-100497575 TAGCTCACCCTCCGAGGAGCTGG - Intronic
1060414307 9:123419897-123419919 TGGCTGAAGCTCTGAAGTGGAGG - Intronic
1060579536 9:124732162-124732184 TGATTCAAGCTCTGAGGTGGTGG - Intronic
1061258273 9:129465369-129465391 TGGGTCAGCCTCTGAGGGGGTGG - Intergenic
1061332250 9:129902494-129902516 TGGCTCAGCCTTTGAGGAGCTGG - Intronic
1061332512 9:129904626-129904648 GGTCTCAGCCTCTTAGGTGGAGG - Intronic
1062002706 9:134224908-134224930 TGCCTCCCCATGTGAGGTGGGGG + Intergenic
1062008464 9:134253530-134253552 TGGCTGAACCTGGGAGGTGGAGG + Intergenic
1062329257 9:136029854-136029876 TGGCTCACCCTCAGAGGTGTGGG + Intronic
1186017867 X:5218288-5218310 TGGCCCCCCTGCTGAGGTGGGGG - Intergenic
1186683293 X:11898207-11898229 TGGCTTTTCCTCTGAGATGGAGG + Intergenic
1189811758 X:44787635-44787657 TGCCTCAGCCTCTGAGTAGGTGG + Intergenic
1195541770 X:106070116-106070138 AGGCTTTCCTTCTGAGGTGGAGG + Intergenic
1196617534 X:117784901-117784923 TGCCTCAGCCTCTGAGTTGCTGG + Intergenic
1198115647 X:133542438-133542460 ATGCTCACCCTCTGAGGGTGTGG + Intronic
1200002956 X:153071698-153071720 TGGGTCACCCTCCTAGGTGCTGG + Intergenic
1200004767 X:153078311-153078333 TGGGTCACCCTCCTAGGTGCTGG - Intergenic
1200032699 X:153309346-153309368 TATCTCACCTTCTGAGGTGCTGG + Intergenic
1200123549 X:153802626-153802648 TGGCTTCCACTCTGAGGTGTGGG - Exonic