ID: 986404902

View in Genome Browser
Species Human (GRCh38)
Location 5:7416028-7416050
Sequence GAGGGTACACTGCTGTAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986404896_986404902 2 Left 986404896 5:7416003-7416025 CCATGATGGGGAGAAGAGAGCCA 0: 1
1: 0
2: 1
3: 26
4: 247
Right 986404902 5:7416028-7416050 GAGGGTACACTGCTGTAGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986404902 Original CRISPR GAGGGTACACTGCTGTAGGG AGG Intronic
901310477 1:8265721-8265743 GAGGTCACACGGGTGTAGGGTGG + Intergenic
901829862 1:11885823-11885845 GAGGGTGCACTGCTGGAATGGGG - Intergenic
901880051 1:12188583-12188605 TAGGGTACACTGAGGTGGGGAGG + Intronic
902052549 1:13575734-13575756 TAGGGTACTCTGCTTAAGGGAGG + Intergenic
904303083 1:29568633-29568655 GAGGGTACAGTGCTTTGGGTAGG + Intergenic
907749909 1:57253043-57253065 TATGGGACACTGCAGTAGGGTGG - Intronic
907983606 1:59508809-59508831 GCTGGTTCACTGCTGTAGGTTGG + Intronic
910265190 1:85330967-85330989 GAAGGCACGCAGCTGTAGGGAGG + Intronic
915226904 1:154418378-154418400 GACTGTACACTGCTGGAGAGAGG - Intronic
915511775 1:156390598-156390620 GAGGGGACGCTGGTGTGGGGCGG - Intergenic
918113577 1:181478959-181478981 GATGATACACTGCAGTAGAGGGG + Intronic
918970159 1:191404429-191404451 GAGGTCAAACTGCAGTAGGGTGG + Intergenic
919739971 1:200975455-200975477 GAGGGTAGACTCGGGTAGGGTGG - Intronic
919991075 1:202709175-202709197 GAGGGGCCACTGCAGTGGGGAGG - Intronic
920044612 1:203125299-203125321 GAGGGGACCCTGGTGTGGGGAGG + Intronic
920209724 1:204319564-204319586 GAGGGACCACTCCTGTTGGGTGG - Intronic
921303477 1:213772591-213772613 GAGGGGACACTGGTGGGGGGTGG - Intergenic
922205272 1:223441006-223441028 GAGGCTATACTGGAGTAGGGTGG - Intergenic
922737600 1:227996254-227996276 GAGTTTACACTGCAGCAGGGAGG + Intergenic
1071729546 10:88234073-88234095 GAGGGGCCTCTGCTGCAGGGGGG - Intergenic
1073602671 10:104862012-104862034 GAGGGCATACTGCAGTAGGATGG - Intronic
1075021783 10:118957447-118957469 GAGGTCACACTGGAGTAGGGTGG + Intergenic
1075955697 10:126520917-126520939 GAGGTCACACTGGAGTAGGGTGG - Intronic
1076335401 10:129703469-129703491 GAGGGTACACTGTGGGAGAGGGG - Intronic
1077247208 11:1545478-1545500 GAGGCCACACTGGAGTAGGGTGG + Intergenic
1080320600 11:31004747-31004769 ATGGTTACACTGCTGTTGGGAGG - Intronic
1082980987 11:59120747-59120769 GAGGTCACACTGCAGTAGGATGG - Intronic
1084268182 11:68015483-68015505 GAGGGTGCACTGGGGCAGGGGGG + Intronic
1084273490 11:68040762-68040784 CAGGGAGCACTGCTGTGGGGGGG - Intronic
1085404476 11:76253904-76253926 GAGGTCATACTGCTGTAGGGTGG - Intergenic
1085452197 11:76641145-76641167 GAGGCTACACTGAAGTAGGGTGG + Intergenic
1085493745 11:76947287-76947309 GAGGGTACACTGCACTATGCAGG + Intronic
1087249238 11:95877620-95877642 GAGGTCATACTGGTGTAGGGTGG + Intronic
1090440995 11:126725652-126725674 CAGGGTGCACTGCTGCAGGCTGG + Intronic
1091577723 12:1754595-1754617 GGGGGTCCATTGCTGGAGGGAGG + Intronic
1098146816 12:67506020-67506042 GAGGGCACACTGGAGTAGGGTGG + Intergenic
1101795918 12:107973542-107973564 GAGGTTATACTGGTGTAGAGTGG - Intergenic
1104081898 12:125436436-125436458 GAGGTTACACTGGAGTTGGGTGG + Intronic
1104954714 12:132458596-132458618 GAGGGTGCACTGTGGTGGGGTGG - Intergenic
1106447771 13:29851610-29851632 GAGGTCACACAGCTGTAGGTTGG - Intergenic
1113518221 13:110919387-110919409 GAGGTCACACTGAAGTAGGGTGG + Intergenic
1114454065 14:22844214-22844236 GGGGGTACTCTGTGGTAGGGCGG + Intronic
1116479914 14:45385144-45385166 GAGTGAACACTGGTGTAGGCAGG - Intergenic
1119667590 14:76496411-76496433 GAGTGTAAACTTCTGTAGTGGGG + Intronic
1120091742 14:80340389-80340411 AAGGGTATACAGCTGTAGGAGGG - Intronic
1121715625 14:96071779-96071801 GAGTGTAGACAGCTGCAGGGAGG + Intronic
1122008527 14:98726591-98726613 AAAGTCACACTGCTGTAGGGTGG - Intergenic
1122175106 14:99911493-99911515 GATGGCACACTGGTGTCGGGAGG + Exonic
1123100566 14:105795931-105795953 GAAGGATCACTGCTGTGGGGAGG + Intergenic
1124195173 15:27619293-27619315 GAGGGCAAACTGGAGTAGGGGGG - Intergenic
1125919605 15:43517731-43517753 GGGGGTACACTGTGATAGGGAGG + Intronic
1127074406 15:55311500-55311522 GAGGGGACGCTGGGGTAGGGAGG + Intronic
1128551122 15:68598632-68598654 GAGAGTACGCTGCTGCAGAGGGG - Intronic
1130638955 15:85652908-85652930 GAGGTTATACTGGAGTAGGGTGG - Intronic
1134008194 16:10832505-10832527 GAGGTCACACTGGAGTAGGGTGG - Intergenic
1136628710 16:31477048-31477070 AAGGGTACAGGGCTGTGGGGCGG + Intronic
1138507284 16:57484681-57484703 GAGGGAACAATGTTGTAGGTGGG - Intronic
1141027892 16:80565090-80565112 GAGGTCACACTGGAGTAGGGTGG - Intergenic
1141689015 16:85586189-85586211 GAGGTCACACTGGGGTAGGGTGG - Intergenic
1142053860 16:87979367-87979389 GAGGGTGGTCTGCTGTGGGGTGG + Intronic
1143724759 17:8837344-8837366 GAGGGCACACTGAGGTCGGGAGG - Intronic
1146260392 17:31416768-31416790 CAGGGTCCACTGCTGTAAGAGGG + Intronic
1147334638 17:39719892-39719914 GGGTGGTCACTGCTGTAGGGAGG + Intronic
1153401432 18:4687671-4687693 GGGGGGACACTGGGGTAGGGAGG - Intergenic
1158201649 18:54948205-54948227 GAGGTCACACTGGAGTAGGGTGG + Intronic
1158628300 18:59090463-59090485 GAGGTCATACTGGTGTAGGGTGG - Intergenic
1158963954 18:62607639-62607661 GAGGTTATACTGGAGTAGGGTGG - Intergenic
1160054054 18:75462967-75462989 GAGGGAACACTGCTTCTGGGGGG - Intergenic
1160701503 19:509689-509711 GAGGTCACACTGGAGTAGGGTGG - Intronic
1161554382 19:4932410-4932432 GAGATCACACTGCAGTAGGGTGG - Intronic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
1167036270 19:46996778-46996800 CAAAGTAAACTGCTGTAGGGAGG - Intronic
1167511000 19:49895307-49895329 GAGGGTCCCCTTCTGTATGGAGG + Intronic
1167810347 19:51824296-51824318 GGGGTGACACTGCTGTAGAGAGG + Exonic
926497280 2:13605792-13605814 GAAGGGACACTGCTGTGTGGGGG - Intergenic
927985569 2:27408392-27408414 GAGGGAAAACTGCGGTAGGGAGG - Intronic
932196041 2:69784929-69784951 GAGGTGATACTGGTGTAGGGTGG - Intronic
936483511 2:112907061-112907083 GAGCTTACAGTGATGTAGGGTGG - Intergenic
937453870 2:122024920-122024942 GAGGCTAAACTGCTGTGGGGGGG + Intergenic
946059007 2:216925847-216925869 GAGGTCACACTACAGTAGGGAGG - Intergenic
1169781525 20:9315557-9315579 GAGGGGACATTGCTGTGGGTTGG + Intronic
1171396347 20:24836250-24836272 GAGGGTAGGCAGCTGGAGGGTGG - Intergenic
1171428124 20:25061245-25061267 GAGGGTACACTGGATCAGGGAGG - Intergenic
1176250288 20:64117346-64117368 GAGGGCACCCTGATGTGGGGGGG + Intergenic
1176250305 20:64117395-64117417 GAGGGCACCCTGATGTTGGGGGG + Intergenic
1176250362 20:64117596-64117618 GAGGGCACCCTGATGTGGGGGGG + Intergenic
1176250377 20:64117645-64117667 GAGGGCACCCTGATGTTGGGGGG + Intergenic
1176250393 20:64117696-64117718 GAGGGCACCCTGATGTTGGGGGG + Intergenic
1176250409 20:64117746-64117768 GAGGGCACCCTGATGTGGGGGGG + Intergenic
1176250425 20:64117797-64117819 GAGGGCACCCTGATGTGGGGGGG + Intergenic
1176250454 20:64117893-64117915 GAGGGCACCCTGATGTGGGGGGG + Intergenic
1176250488 20:64117995-64118017 GAGGGCACCCTGATGTTGGGGGG + Intergenic
1176250531 20:64118149-64118171 GAGGGCACCCTGATGTTGGGGGG + Intergenic
1176250577 20:64118300-64118322 GAGGGCACCCTGATGTTGGGGGG + Intergenic
1176250608 20:64118401-64118423 GAGGGCACCCTGATGTGGGGGGG + Intergenic
1176250624 20:64118452-64118474 GAGGGTACCCTGATGTTGGGGGG + Intergenic
1176250640 20:64118503-64118525 GAGGGCACCCTGATGTTGGGGGG + Intergenic
1176250655 20:64118550-64118572 GAGGGCACCCTGATGTGGGGGGG + Intergenic
1176250671 20:64118600-64118622 GAGGGCACCCTGATGTGGGGGGG + Intergenic
1176250686 20:64118647-64118669 GAGGGCACCCTGATGTGGGGGGG + Intergenic
1176250701 20:64118697-64118719 GAGGGTACCCTGATGTTGGGGGG + Intergenic
1176250735 20:64118800-64118822 GAGGGCACCCTGATGTTGGGGGG + Intergenic
1176250751 20:64118851-64118873 GAGGGCACCCTGATGTTGGGGGG + Intergenic
1176250798 20:64119004-64119026 GAGGGCACCCTGATGTTGGGGGG + Intergenic
1176250812 20:64119055-64119077 GAGGGCACCCTGATGTTGGGGGG + Intergenic
1176250828 20:64119105-64119127 GAGGGCACCCTGATGTGGGGGGG + Intergenic
1176250858 20:64119207-64119229 GAGGGCACCCTGATGTCGGGAGG + Intergenic
1178746185 21:35252372-35252394 GAGGGACCACTGATGTAGGTAGG - Intronic
1179591900 21:42414583-42414605 GAGGTCACACTGCATTAGGGTGG + Intronic
1180093713 21:45544783-45544805 GATGGGGCACTGCTGTGGGGTGG - Intergenic
1183143001 22:35961849-35961871 GAGGGTACAATGTTGGAAGGAGG - Intronic
1184605205 22:45569033-45569055 GAGGTCACACTGGAGTAGGGTGG - Intronic
1184843087 22:47063933-47063955 GAGGCCACACTGGAGTAGGGGGG - Intronic
1184843107 22:47064023-47064045 GAGGCCACACTGGAGTAGGGGGG - Intronic
953783024 3:45888244-45888266 GAGGGAACATTGCTCCAGGGTGG - Intronic
954436849 3:50500789-50500811 GAGGGGTTACTGCTGAAGGGAGG - Intronic
956132833 3:66070277-66070299 TAGGGTACACTGCTCTGGTGAGG + Intergenic
957152640 3:76505511-76505533 GAGGTCATACTGCGGTAGGGTGG + Intronic
957380086 3:79416484-79416506 GAGGGCACACACCTCTAGGGAGG + Intronic
958799972 3:98744004-98744026 GAGGTCACACTGGAGTAGGGTGG + Intronic
961352868 3:126315213-126315235 GAGGTTGCACTGGAGTAGGGTGG - Intergenic
962360113 3:134733532-134733554 GAGGTTATACTGGGGTAGGGTGG + Intronic
963667222 3:148203490-148203512 GAGGGAACACATCTGTAGGAAGG + Intergenic
964988836 3:162780455-162780477 GAGGGTACAGTTCTAAAGGGTGG + Intergenic
966353387 3:179055459-179055481 GAGGGGACGCTGGGGTAGGGAGG - Intronic
967002507 3:185349857-185349879 GTGCGTACACTGCAGTAGGCAGG + Intronic
968891587 4:3372219-3372241 CAGGGTGCCCTGCTGTGGGGTGG + Intronic
969694572 4:8727423-8727445 GAGGTCACACTGGAGTAGGGTGG - Intergenic
973671846 4:53227584-53227606 GAAGGTATTCTGCTGTAGTGAGG - Intronic
974278292 4:59756370-59756392 GAGGTCACACTGTAGTAGGGAGG + Intergenic
975318168 4:72978995-72979017 GAGGATATACTGAAGTAGGGTGG + Intergenic
977460926 4:97324093-97324115 GAGTTTATACTGGTGTAGGGTGG - Intronic
981104870 4:140868983-140869005 AAGGGTACACTGAGGTAGGTAGG + Intronic
982685739 4:158486646-158486668 GAGGTCACACTGGAGTAGGGTGG - Intronic
982783798 4:159519517-159519539 GAGCTTACACTCCTGTAGAGGGG - Intergenic
985993526 5:3583501-3583523 GAGGTCACACTGGAGTAGGGTGG + Intergenic
986404902 5:7416028-7416050 GAGGGTACACTGCTGTAGGGAGG + Intronic
990314363 5:54570087-54570109 GAGGGTATACTGGAATAGGGTGG + Intergenic
992752036 5:79870684-79870706 GAGGGTGCTCAGCTGTAGGGAGG + Intergenic
995906652 5:117132250-117132272 GAGGCTACACTGGAGTTGGGTGG - Intergenic
996683261 5:126251280-126251302 AAGGTTACACTGGAGTAGGGTGG - Intergenic
997439696 5:133900498-133900520 GAGAGTACATGGCTGTGGGGAGG + Intergenic
997723208 5:136097432-136097454 GAGGGAGCACTGATGGAGGGAGG + Intergenic
1001145793 5:169183306-169183328 GAGAGTACACTGATGTATGAAGG + Intronic
1001400167 5:171441666-171441688 GAGTGTAAACTTCTGGAGGGTGG + Intronic
1007842093 6:44725015-44725037 GAGGGGTCACTGCTGTCGGGAGG - Intergenic
1009482904 6:64182841-64182863 GAGGGTAGACAGGAGTAGGGTGG - Intronic
1010498560 6:76566729-76566751 CAGGGCACACTGCTGCAAGGGGG + Intergenic
1015159674 6:130138532-130138554 GAGGTCACACTGGAGTAGGGTGG - Intronic
1016916564 6:149249318-149249340 GAGGGTCCAATGCTGAAGAGGGG - Intronic
1017253719 6:152309841-152309863 GATGTTACACTGCTGGATGGCGG + Exonic
1018824430 6:167398556-167398578 GAGGTCACACTGATGTAGCGTGG - Intergenic
1019769657 7:2875791-2875813 GAGGATACACTGGAGTAGGAAGG - Intergenic
1021621164 7:22552351-22552373 GAGGTCACACTGGAGTAGGGAGG - Intronic
1025640704 7:63365382-63365404 CAGGGTCCTCTGTTGTAGGGAGG + Intergenic
1025641995 7:63382704-63382726 CAGGGTCCTCTGTTGTAGGGAGG - Intergenic
1026106310 7:67423632-67423654 GAGGGTAAACTGCTTTAAGTAGG + Intergenic
1027803860 7:82790561-82790583 TAAGGTACTCTGCTGTAGGAAGG - Intronic
1029691956 7:102188457-102188479 GAGGAGCCATTGCTGTAGGGTGG - Intronic
1029884668 7:103855851-103855873 GAGGTTATACTGGAGTAGGGTGG - Intronic
1033405769 7:141071174-141071196 GAGGGTGCACTGGTTAAGGGGGG + Intergenic
1034244441 7:149633962-149633984 GAGGGGACTCTGGGGTAGGGTGG + Intergenic
1034672426 7:152868792-152868814 GAGGTCACACTGGAGTAGGGTGG - Intergenic
1037578909 8:20233136-20233158 GAGGTCACACTGAAGTAGGGTGG + Intergenic
1040480054 8:47817234-47817256 GTGGGGACGCTGCTGTCGGGAGG - Intronic
1042351486 8:67781799-67781821 GAGGGGACAATGCTGAAGGAGGG - Intergenic
1044215575 8:89605867-89605889 GAGTGTACACTGGGGTAGTGTGG - Intergenic
1046044632 8:108948916-108948938 CAAGGTACTCTGCTGTAGAGAGG - Intergenic
1048344594 8:133567231-133567253 GAGGTCACAGTGCTGTGGGGAGG - Intronic
1050403691 9:5284683-5284705 GAGGCTCCGCTGCTGTGGGGTGG + Intergenic
1053565093 9:39241402-39241424 GAGGTTGCCCTGCTGTATGGGGG - Intronic
1054132057 9:61377636-61377658 GAGGTTGCCCTGCTGTATGGGGG + Intergenic
1055319896 9:75073099-75073121 GAGGTCACACTGGAGTAGGGTGG + Intronic
1056678696 9:88698275-88698297 GAGTTTACACTTCAGTAGGGAGG + Intergenic
1057308959 9:93929615-93929637 GATGTCACACTGATGTAGGGTGG + Intergenic
1057535185 9:95895649-95895671 GAGGTCACTATGCTGTAGGGAGG - Intronic
1058689979 9:107511703-107511725 GAAGGTACTCTGCTGTATGATGG + Intergenic
1060023601 9:120152470-120152492 GAGGGGACAGTGCTGCAGGCAGG + Intergenic
1062258364 9:135642700-135642722 GAGGTCACACTGCAGTAGGGTGG - Intergenic
1186865609 X:13717889-13717911 GAGGTCACACTGGAGTAGGGTGG + Intronic
1188401996 X:29756839-29756861 GAGGTTATGCTGGTGTAGGGTGG + Intronic
1188880538 X:35486701-35486723 GAGAGTGCACTGCGGCAGGGTGG + Intergenic
1189193627 X:39133374-39133396 GGGGGTACACTGAGGAAGGGAGG + Intergenic
1195552126 X:106182717-106182739 GTGGGGGCACTGCTGCAGGGGGG + Intronic
1197260043 X:124307712-124307734 TAGTGTAAACTGCTGTTGGGTGG + Intronic
1198668138 X:139046883-139046905 GAGGGTGCACTGTAGTAGAGGGG - Intronic