ID: 986405860

View in Genome Browser
Species Human (GRCh38)
Location 5:7424380-7424402
Sequence CTGTGTGACTTTGAGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 12, 3: 53, 4: 358}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986405860_986405867 27 Left 986405860 5:7424380-7424402 CCAACTTCCTCAAAGTCACACAG 0: 1
1: 0
2: 12
3: 53
4: 358
Right 986405867 5:7424430-7424452 GGCATTCTGCCACCATCACATGG No data
986405860_986405864 0 Left 986405860 5:7424380-7424402 CCAACTTCCTCAAAGTCACACAG 0: 1
1: 0
2: 12
3: 53
4: 358
Right 986405864 5:7424403-7424425 TGAGGAAGAGGACCAGAATTTGG No data
986405860_986405865 6 Left 986405860 5:7424380-7424402 CCAACTTCCTCAAAGTCACACAG 0: 1
1: 0
2: 12
3: 53
4: 358
Right 986405865 5:7424409-7424431 AGAGGACCAGAATTTGGACTTGG 0: 1
1: 0
2: 0
3: 18
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986405860 Original CRISPR CTGTGTGACTTTGAGGAAGT TGG (reversed) Intronic
900388729 1:2423819-2423841 CTGTGTGATTCTGGGGCAGTAGG + Intergenic
901721249 1:11199750-11199772 AGGTGTGACTTTGAGGCAGCAGG - Intronic
903366214 1:22806908-22806930 CTGTGTGTCTCTGGGGAAGTAGG - Intronic
903590010 1:24447764-24447786 CTGTGTGACTTGGAAAAAGAAGG + Intronic
903844445 1:26269685-26269707 CTGTGTGACTTTGGGTGATTTGG + Intronic
903882510 1:26521141-26521163 CTGTGTGACTTTGAGTATTTCGG - Intergenic
904301524 1:29557541-29557563 GTGTGGGACTTGGTGGAAGTTGG + Intergenic
904825290 1:33270306-33270328 CTGTGTGATTTGGGGCAAGTTGG + Intronic
906019600 1:42615692-42615714 CTGTGTGACTTTTAGCAACAAGG + Intronic
906612072 1:47210425-47210447 CTGTCTGACTCTGTGGAAGCAGG + Intergenic
906613930 1:47222335-47222357 CTGTGTGACCTTGATCAAGCTGG + Intronic
907248216 1:53121387-53121409 CTGTGTGACATCGAGACAGTTGG + Intronic
907955033 1:59220186-59220208 TTGTGTGACTTTGAGCAAGTTGG - Intergenic
908437814 1:64123485-64123507 CTGTGTGATCTTGGGAAAGTTGG + Intronic
909265500 1:73553009-73553031 CTGGGTGAATTGGAGGAAGCTGG - Intergenic
909461747 1:75923790-75923812 CTGTGTGATTTTGAGCAAGTTGG + Intronic
910209636 1:84779881-84779903 CTGTGGGTCTTGGAGGAGGTTGG - Intergenic
911886943 1:103313847-103313869 CTGTGTGTCTTTGGGTAAGTTGG - Intergenic
911906548 1:103576249-103576271 CTGTGTGACTCAGAGGAAGGAGG - Intronic
911913152 1:103661399-103661421 CTGTGTGACTCATAGGAAGGAGG - Intronic
911915302 1:103690549-103690571 CTGTGTGACTCATAGGAAGGAGG + Intronic
911920565 1:103755537-103755559 CTGTGTGACTCATAGGAAGGAGG - Intronic
912531669 1:110328565-110328587 CTGAGTCATTTAGAGGAAGTTGG + Intergenic
912702691 1:111889906-111889928 ATGTGTGAATTTCAGGCAGTGGG + Intronic
913133981 1:115869631-115869653 CTTTGTTACTTTGAAGAAGCAGG - Intergenic
914735001 1:150407694-150407716 CTAAGTGATTTTAAGGAAGTTGG + Intronic
915366367 1:155319029-155319051 CTGTGTGACCTTGAGCAAGTCGG + Intronic
915943499 1:160133982-160134004 CTGTGTGAATTTGAGTGGGTGGG - Intronic
916146568 1:161745446-161745468 CTTTGTGCCTTTGAAGATGTTGG + Intergenic
916391455 1:164335329-164335351 CTGTGTGACCTTGGGTAAGTGGG + Intergenic
917218939 1:172706798-172706820 GTGTGTGACTTGGGGGAAGGAGG - Intergenic
917512626 1:175680921-175680943 TGGTGTGACATTGGGGAAGTTGG + Intronic
917647306 1:177041807-177041829 CTGCCTGACTTTGAGGAAATGGG - Intronic
919693120 1:200545076-200545098 CTGGGTGACTTTGTGGATGGTGG + Intergenic
920375686 1:205506619-205506641 CTGTGTGACCTTGGAAAAGTTGG - Intronic
921808167 1:219479681-219479703 CTGTGTTATTTAGAGGAAATAGG - Intergenic
921822111 1:219629276-219629298 GTCTGTGCCTTTAAGGAAGTTGG + Intergenic
922570659 1:226633024-226633046 GTGTGTGACCTTTAGCAAGTCGG + Exonic
923017020 1:230134712-230134734 CTGTGTGACTGAGAGGAGCTGGG + Intronic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1062875640 10:940977-940999 CTGTCCGTCTTAGAGGAAGTGGG - Intergenic
1063292473 10:4763583-4763605 CTGTGGGACATTGAGGCAGTAGG + Intergenic
1063663296 10:8048240-8048262 CTGGGTGGCTGTGAGGATGTGGG + Intergenic
1063876283 10:10482786-10482808 CTGTGTGAGTTAGATGAAGGGGG - Intergenic
1064550929 10:16500163-16500185 CGGAGTGACTTTGGGGAAGCTGG - Intronic
1064998688 10:21318037-21318059 CTGTGAGACTCTGAGGCAGCTGG - Intergenic
1067461619 10:46462425-46462447 GTGTGTGACTGTGAGGCAGAAGG - Exonic
1067905370 10:50285299-50285321 CAGGGTGGCCTTGAGGAAGTGGG - Intergenic
1067956554 10:50797456-50797478 TTGTGTGAATATCAGGAAGTGGG + Intronic
1069685457 10:70315436-70315458 CTGTGTGACTTTCAGCAACAAGG - Intronic
1069739526 10:70678714-70678736 CTGCGTGACTCTGAGCAAGCTGG + Intronic
1069814092 10:71182420-71182442 CTGTGTGGCCTTGGGCAAGTAGG + Intergenic
1069818975 10:71216121-71216143 CAGTGTGACCTTGGGCAAGTTGG - Intronic
1069834170 10:71298125-71298147 CTGTGAGACCTTGAGGACGAAGG - Intronic
1069905032 10:71727209-71727231 CTGTGTGACCCTGAACAAGTCGG - Intronic
1072531600 10:96324548-96324570 CTGTGTGATCTTGAGCAAGTTGG + Intronic
1072654932 10:97323346-97323368 GTGTGTGAATTTGAGAAAATGGG - Intergenic
1072779563 10:98237949-98237971 CTGTGTGACCTTGAGAGGGTAGG + Intronic
1073419829 10:103415635-103415657 CTGTGTGACTCTGGGCAAGACGG - Intronic
1073917367 10:108421403-108421425 CTGGCTGGCTTTGAGGAAGTAGG + Intergenic
1074080567 10:110165173-110165195 CTGTGTGACTCTGGGTAAGTGGG + Intergenic
1074166202 10:110877785-110877807 CTCTTTTACTTGGAGGAAGTAGG + Intronic
1075325293 10:121526908-121526930 GTGTGTGTTTTAGAGGAAGTGGG - Intronic
1075411427 10:122231351-122231373 CTCTGTGGCTTTGAACAAGTAGG + Intronic
1075573430 10:123561202-123561224 CTGTTGGAAATTGAGGAAGTTGG - Intergenic
1075659087 10:124181006-124181028 CTGTGTGATCTTGGGCAAGTTGG - Intergenic
1078464028 11:11537193-11537215 CTGTGTGACTTTAGGCAAGCTGG - Intronic
1079029991 11:16979455-16979477 CTGTGTGACCTTGAGCAAGGTGG - Intronic
1079355745 11:19729207-19729229 CTGGGTGACTTGGAGCAAGCAGG + Intronic
1079501605 11:21106889-21106911 CTGTGTTCCTTTGGGCAAGTTGG + Intronic
1080925182 11:36748811-36748833 CTGTGTGGCCTTAAGCAAGTTGG - Intergenic
1081273236 11:41113476-41113498 CTGAGTGACTTTCAGAAATTTGG - Intronic
1081866523 11:46363405-46363427 CTGTGTGACTGTGTGCAAGTTGG - Intronic
1082031909 11:47610775-47610797 CTGTGAGACCTTGGGAAAGTTGG - Intergenic
1082126177 11:48433631-48433653 TTGTGTGTCTTGGATGAAGTGGG + Intergenic
1082781081 11:57287906-57287928 ATGTGTGACACTTAGGAAGTGGG - Intergenic
1083925358 11:65802901-65802923 CCGTGTGACCTTGAGCAAGATGG - Intergenic
1084994251 11:72959930-72959952 CAGTCTAACTTTGAGGAAGATGG + Intronic
1085345355 11:75765085-75765107 CTGTGTGAGTTTGGGCAAGGGGG - Intronic
1085662229 11:78378973-78378995 CTGTGTGATTCTGGGGAAGCTGG - Intronic
1085760986 11:79241352-79241374 CAGTGTGACTTGGAGAGAGTGGG + Intronic
1086151328 11:83614045-83614067 CAGTGTGAACTTGATGAAGTAGG + Intronic
1086335281 11:85794521-85794543 TTTTGTGACCTTGAGAAAGTGGG - Intronic
1086419617 11:86625837-86625859 GAGTGTAACTTTGAGTAAGTAGG + Intronic
1087022257 11:93615392-93615414 CTGTGAGTGTTTGAGGGAGTGGG - Intergenic
1087566016 11:99859014-99859036 CTATGCTACTTTGAGCAAGTTGG - Intronic
1088175617 11:107050091-107050113 CTATGTGATTCTGAGGCAGTAGG - Intergenic
1088338291 11:108733363-108733385 CTTAGTGACTTTTAGGAACTTGG + Intronic
1088580383 11:111310118-111310140 CTTTGTGTATATGAGGAAGTTGG - Intergenic
1089829100 11:121309409-121309431 CTGTGTGCCTGGGAGGAAGGGGG + Intergenic
1091589052 12:1832243-1832265 CTGTGTGATCTTGAGAAAGCTGG + Intronic
1094077469 12:26493084-26493106 CTGAGGGAATTTGAGGAAGGAGG - Intronic
1094432458 12:30384753-30384775 CTGATTGACTTTGAGGAAGGAGG + Intergenic
1096200758 12:49680843-49680865 CTGTGTAACCTTGAGCCAGTTGG - Intronic
1096342894 12:50817154-50817176 CTGTGTGACTGAGAGGAACTTGG + Intronic
1096693610 12:53335540-53335562 CTATGTGAGTTGGAGGAGGTGGG + Intronic
1097451890 12:59746780-59746802 CTTTCTGACTTTGAGGGGGTAGG - Intronic
1098378674 12:69844651-69844673 CTGTGTGACTCTGGGCAAGCTGG + Intronic
1098553184 12:71787717-71787739 TTATGTGTTTTTGAGGAAGTTGG + Exonic
1099243319 12:80164089-80164111 CTGTGTAACTTTGTGAAAATTGG + Intergenic
1099411509 12:82334675-82334697 CTGTGTGTGTATGGGGAAGTGGG - Intronic
1101279219 12:103234397-103234419 TTTTGTGAATCTGAGGAAGTGGG + Intergenic
1101432595 12:104639043-104639065 CTTGGTGACTTTTAGGAACTGGG + Intronic
1101995831 12:109524281-109524303 ATTCGTGACTTTGAGGAAGGAGG - Intronic
1102209781 12:111117934-111117956 CTGTGTGACCTTGGGCATGTTGG - Intronic
1102640130 12:114360176-114360198 CTGAGTGACCTTCAGCAAGTTGG + Intronic
1102659989 12:114517991-114518013 CTGTGTCACTTTGGACAAGTTGG + Intergenic
1103765408 12:123275961-123275983 CTTTGTGAGGTTGAGGAAGGCGG + Intergenic
1105564910 13:21535717-21535739 CTGTGTAACCTTGGGCAAGTTGG - Intronic
1106070046 13:26401853-26401875 CTGTGTGACCTTGGACAAGTAGG + Intronic
1106662528 13:31814741-31814763 GTCTGTGCATTTGAGGAAGTGGG - Intergenic
1107633430 13:42367089-42367111 CTGTGTGTCTTTCAAGAAATTGG - Intergenic
1108173004 13:47762656-47762678 CAGTGTGGCTCTTAGGAAGTAGG + Intergenic
1108196164 13:47997622-47997644 AGGTGTGACTTTGGGCAAGTAGG - Intronic
1108225013 13:48280325-48280347 CTTTGTGAGTTCGAGGAAGGTGG - Intergenic
1108288892 13:48937746-48937768 CTGTGTGACTTTGAGTTAACTGG - Intergenic
1108680313 13:52774446-52774468 CTGTGTGTATATGAAGAAGTGGG + Intergenic
1109578123 13:64288889-64288911 CTGTGCTATTTTGTGGAAGTTGG - Intergenic
1110133076 13:72031072-72031094 CTTTGTGAAGTTGAGGAAGCAGG + Intergenic
1110954864 13:81541440-81541462 ATGTGTGACACTGAAGAAGTAGG - Intergenic
1111763969 13:92502576-92502598 CTGTGTTAATTAGATGAAGTGGG + Intronic
1114048901 14:18903209-18903231 GTGTGTAACGTTGAGAAAGTGGG - Intergenic
1114113661 14:19498724-19498746 GTGTGTAACGTTGAGAAAGTGGG + Intergenic
1114115361 14:19616473-19616495 GTGTGTAACCTTGAGAAAGTGGG + Intergenic
1115208581 14:30941388-30941410 CTGTGTGACTTCCAGTATGTTGG - Intronic
1115694218 14:35879045-35879067 CTCTGTGACCGTGAGGAAGTGGG + Intronic
1116425130 14:44781758-44781780 CTGTGTGCCTTTGGGCAAGTGGG - Intergenic
1116515296 14:45797433-45797455 TTGTGTGACTTTGGGCATGTTGG - Intergenic
1116625292 14:47255364-47255386 CTGTGTGCCTTACAGGTAGTGGG + Intronic
1117336766 14:54762613-54762635 CTGTGGGTCTCTCAGGAAGTAGG - Intronic
1118711860 14:68526024-68526046 CTCTGTGACATTGGGAAAGTTGG + Intronic
1118846416 14:69550830-69550852 CTGTGTGAGTGTGAGGTAGGTGG + Intergenic
1120188538 14:81419299-81419321 TTGTGTGACCTTGAGAAAGTTGG - Intronic
1122472062 14:101975517-101975539 CTGTGTGACTTTGGGCAAGGCGG - Intronic
1123776225 15:23583371-23583393 TTGTATGAATTTGAGGAACTAGG - Intronic
1124148113 15:27149957-27149979 CTGTGTGATCTTGGGCAAGTAGG + Intronic
1124846482 15:33296242-33296264 CTGTGACACTTCCAGGAAGTTGG - Intergenic
1126572548 15:50167731-50167753 GTGTGTGGCTTTAAGCAAGTTGG + Intronic
1126714228 15:51497046-51497068 CTGTGGGACATTAAGAAAGTAGG - Intronic
1127899320 15:63329583-63329605 GTGTGTGTCTTGGAGGAAGAAGG + Intronic
1128111675 15:65080040-65080062 CTGTGTGGCTTTGGGCCAGTGGG - Intergenic
1128803974 15:70517137-70517159 CTGTGTGACTTGGAGCAATAAGG + Intergenic
1129462736 15:75707998-75708020 CTGTGTGACTCTGAACAAGCAGG + Intronic
1129675405 15:77630577-77630599 CTGTGTGACTGGGAGGGAGGTGG - Intronic
1129722138 15:77883418-77883440 CTGTGTGACTCTGAACAAGCAGG - Intergenic
1129952352 15:79603001-79603023 CTATGTGACCTTCAGCAAGTTGG - Intergenic
1130022490 15:80242922-80242944 ATGTGTGGCTTTAAAGAAGTAGG + Intergenic
1130058918 15:80555563-80555585 CTGGCTGACTTGGAGGAGGTGGG + Intronic
1130614789 15:85394722-85394744 CTGTGTGACCTTGAGCAGGTAGG + Intronic
1130939926 15:88498822-88498844 CTGAGAGACTTTGAGGAAGAGGG - Intergenic
1131876555 15:96813081-96813103 CTGTCTCACTGTGAGGAAGTTGG + Intergenic
1133100648 16:3477435-3477457 CTGTGCGTCTTTGTGGAAGCGGG + Intronic
1133385610 16:5367788-5367810 CTGTGTTACTTTCTGGATGTGGG - Intergenic
1134796385 16:17040894-17040916 CTGTGTGACCTTGGGAAGGTTGG - Intergenic
1135323043 16:21509567-21509589 CTGTGTGACTTTCAGCAAGTGGG - Intergenic
1136334526 16:29602753-29602775 CTGTGTGACTTTCAGCAAGTGGG - Intergenic
1137404874 16:48181538-48181560 CTGTGTGGCTTTGGGTAAATTGG - Intronic
1138402486 16:56758139-56758161 CTCTGTGACTTTGGGCAAGCTGG + Intronic
1138809087 16:60127813-60127835 CTGTGGGAATTTGAGGAGGGAGG + Intergenic
1139915793 16:70427723-70427745 CTGTGAGAGGTTGAGGAAGGAGG - Intronic
1141076947 16:81015336-81015358 CTGTGAGCCCTGGAGGAAGTTGG + Intronic
1141097344 16:81172272-81172294 CTGTGTGCCTTTGCAGCAGTGGG + Intergenic
1141474878 16:84266158-84266180 CTGTGTGAATTTGTGGCAGGAGG - Intergenic
1141578714 16:84982665-84982687 GTGAATGCCTTTGAGGAAGTTGG - Intronic
1142035238 16:87858589-87858611 CTGTGTGACTTTCACCAAGTGGG - Intronic
1142931118 17:3284758-3284780 CTGGGGGACTTTGAGGACATAGG - Intergenic
1142944296 17:3411749-3411771 CTGGGGGACTTTGAGGACATAGG + Intergenic
1146127277 17:30239172-30239194 CTTTGAGACTTCCAGGAAGTGGG - Intergenic
1147533992 17:41306454-41306476 ATGAGTGTCTTGGAGGAAGTAGG + Intergenic
1148848841 17:50544485-50544507 CTGGGTGACTCTGAGAATGTGGG - Intronic
1149070109 17:52531012-52531034 CTCTGTGTCTTTGAGGCAGATGG + Intergenic
1149227092 17:54484874-54484896 CAGTGAGACTTTGAGCAAGTTGG + Intergenic
1150306202 17:64087461-64087483 TTGTGTGACTGGGTGGAAGTGGG - Intronic
1150614840 17:66762442-66762464 CTGTGTGACTTTGGGCAAGTTGG - Intronic
1151024293 17:70659162-70659184 CTGTGTAACTATGAGGATGTTGG + Intergenic
1151820867 17:76496080-76496102 CTGGGAGACTTTGGGCAAGTGGG + Intronic
1154325869 18:13389938-13389960 GTGGGTGACTGTGAGCAAGTGGG - Intronic
1155696355 18:28691481-28691503 CTTTTTAACTTTGAGGAAGGTGG - Intergenic
1156260331 18:35440167-35440189 CTCTGTGACTCTGAGGAAAACGG + Intergenic
1156506438 18:37598322-37598344 CTTTGTAACTATCAGGAAGTGGG - Intergenic
1157365638 18:47061689-47061711 CTATGTAACTTTGGGCAAGTTGG + Intronic
1157555341 18:48609884-48609906 CTGGGTGACCTTGAGGGTGTGGG + Intronic
1158624199 18:59057470-59057492 TTGTGTGACCTTGAAGAGGTAGG - Intergenic
1160033267 18:75280612-75280634 CTGTGTTACTTTGGGGAAGTCGG + Intronic
1160611557 18:80091766-80091788 CTTTATGACGTTAAGGAAGTTGG - Intronic
1161146179 19:2679721-2679743 CTGTCCTGCTTTGAGGAAGTGGG - Intronic
1161787875 19:6339405-6339427 CTCTGTGACTCTGAGGACTTTGG - Intergenic
1162534649 19:11255660-11255682 CTGTGTGGCTTTGGGCAGGTAGG + Intronic
1162623718 19:11865782-11865804 CTTTGTGACTCTGAGGCAGGTGG + Intronic
1163144433 19:15371140-15371162 CTGTGTGACTCTAAGGACTTGGG + Intronic
1163523059 19:17803448-17803470 TTCTGTGCATTTGAGGAAGTGGG + Intronic
1164951528 19:32341252-32341274 TTGTGGGACTGTGAGCAAGTGGG - Intergenic
1165891111 19:39112730-39112752 CTGTGTGACCATGGGCAAGTCGG + Intergenic
1167197366 19:48039533-48039555 CTGTGTGACTTTCAGACAGTTGG + Intronic
1167635394 19:50651530-50651552 CTGTGTGCCTTGGAGGATGCTGG - Intronic
925942035 2:8830066-8830088 CTGTGTGACTCAGAGGGAGATGG - Intronic
926901005 2:17752505-17752527 TTGTGTGACTCTGAGCAGGTTGG - Intronic
926938194 2:18107255-18107277 CTGTGTGAGATTGAGGAAGAAGG + Intronic
928561736 2:32495689-32495711 CTGTGTGACTTTGTGTGAGGAGG - Intronic
930917873 2:56715949-56715971 CTGTGTCACATTGTGGCAGTGGG + Intergenic
931678969 2:64727176-64727198 TGGTCTGAGTTTGAGGAAGTGGG + Intronic
931848934 2:66233840-66233862 CTATGTGTATTTGAGGAAGGAGG + Intergenic
932016530 2:68033549-68033571 CTCTTTGTCTTTTAGGAAGTTGG + Intergenic
932434355 2:71694547-71694569 CTGTGTGGGTCTGAGGAAGGTGG - Intergenic
933153310 2:78941053-78941075 CTCTTTGGCTTTGATGAAGTTGG + Intergenic
933534237 2:83552265-83552287 CTGTGTTAGTTTGAGGAGGATGG + Intergenic
933618942 2:84514852-84514874 GTGTGTGACTGTGGTGAAGTGGG - Intergenic
933992180 2:87641608-87641630 CTGGGAGACTTGGAGCAAGTCGG + Intergenic
934932583 2:98440176-98440198 CTGTGAGGCTTTGAGCAAGCAGG - Intergenic
935639605 2:105278533-105278555 CCGCGTGACCTTGAGCAAGTAGG + Intronic
935948466 2:108307272-108307294 CTGTGTGAGTCTGAAGAAGGAGG - Intronic
936301669 2:111309229-111309251 CTGGGAGACTTGGAGCAAGTCGG - Intergenic
936448889 2:112618602-112618624 CTGTGTGAGTTTGAGGAGTCGGG - Intergenic
936506412 2:113111371-113111393 CTGTGTGACTCTGAGCCACTTGG - Intronic
936973104 2:118193361-118193383 TTGTGTGACCTTGAGCAAGAAGG - Intergenic
937571406 2:123367423-123367445 TTGTGTGATGTTGGGGAAGTTGG - Intergenic
938192428 2:129295908-129295930 TTATGTGACCTTGAGGAAGGAGG - Intergenic
938426217 2:131191465-131191487 GTGTGTAACCTTGAGAAAGTGGG - Intronic
939446454 2:142315685-142315707 CTGTGTAAGTTTGAGGAAGCAGG - Intergenic
940823195 2:158380939-158380961 CTATGTGACTGTTGGGAAGTAGG - Intronic
941213915 2:162681317-162681339 CTGGGTGACCTTTAGGAAGAAGG + Intronic
941663663 2:168221722-168221744 CGGTCTGACCTTGAGGAACTTGG - Intronic
942130273 2:172871913-172871935 CTGTGTGACTCCAAGCAAGTTGG - Intronic
942980830 2:182079530-182079552 CTGTCTGACCTTGAGAGAGTGGG + Intronic
943472690 2:188314476-188314498 CTGTGTGACCTTGGGCAAGTGGG - Intronic
944490856 2:200256436-200256458 CTGTGTCACATGGAGGAGGTGGG - Intergenic
944609601 2:201388721-201388743 TTGTGTGACAGTGAGGCAGTAGG + Intronic
947350493 2:229238875-229238897 CTGTGTTACTGTGAGGAAACAGG - Intronic
947788338 2:232845105-232845127 CTGTGTGACCTTGGGCAAGAGGG + Intronic
948433204 2:237933865-237933887 CTGTGTGATTTGGAGGATGGCGG - Intergenic
948737445 2:240018166-240018188 GTGTGTGATTTTGATGAATTGGG - Intronic
948767231 2:240228999-240229021 CTTTGTGAGTTTGAGGCAGGAGG - Intergenic
1171335790 20:24384269-24384291 CTGTTTGAATTTGGGCAAGTTGG - Intergenic
1172578810 20:36030732-36030754 CTGTGGGACTTGGAGGAAGGGGG + Intergenic
1172773040 20:37392643-37392665 CTGTGTGACCTTGAGCAAAGAGG + Intronic
1173234166 20:41228537-41228559 TTGTCTGTCTATGAGGAAGTAGG - Intronic
1173490046 20:43472449-43472471 GTGTGTGACTTTGGGCATGTGGG - Intergenic
1174696495 20:52564933-52564955 CTGTGTGACTTTGAGCACATTGG + Intergenic
1174850377 20:53988209-53988231 CTATGTGACTCTGAGTAAGTGGG - Intronic
1174942804 20:54949375-54949397 ATATGTGAATTTGAGGATGTGGG - Intergenic
1175107505 20:56625742-56625764 CTTTGTGGCTTTCAGGTAGTTGG + Intergenic
1175193040 20:57224186-57224208 CTGAGTCACTCTGAGGAAGAGGG - Intronic
1175668426 20:60880085-60880107 CTGTATGGGTTTGAGGGAGTGGG + Intergenic
1178307924 21:31506057-31506079 CTGTGGGACCTTGAGCAAGTTGG - Intronic
1178398380 21:32262548-32262570 CTGTGTGGATCTGAGGAAATGGG - Intergenic
1178945806 21:36946793-36946815 CTGTGTGTCTGCGAGGAGGTGGG - Intronic
1178965522 21:37113326-37113348 CTCTGAGACTTTGCTGAAGTTGG - Intronic
1179456852 21:41506479-41506501 CTGAGTGCTTTTGAAGAAGTAGG - Intronic
1180206416 21:46264153-46264175 CAGAGGGACTGTGAGGAAGTTGG - Exonic
1181008406 22:20025746-20025768 CTGTGTCACTTTGTGGACTTGGG + Intronic
1181018076 22:20082764-20082786 CTGTATGACCTTGAGCATGTGGG + Intronic
1181271060 22:21658624-21658646 CTGTGTGATCCTGAGCAAGTTGG + Intronic
1181381292 22:22506895-22506917 CTATGTGAATTCCAGGAAGTGGG - Intronic
1181604198 22:23970376-23970398 CAGTGTGAATTTGAGTATGTGGG + Intronic
1181630617 22:24149249-24149271 CTGAGTGGCTTTGAGCAAGCTGG + Intronic
1181720423 22:24770182-24770204 CTGTGTGACCTTGGGTAAGCGGG - Intronic
1181781797 22:25199167-25199189 CTGTGTGATTCTGAGTAAATGGG + Intergenic
1181887925 22:26036363-26036385 CTGTGTGTCTGTGAGGAGATAGG + Intergenic
1181983811 22:26785118-26785140 CTGTGTTACCTTGGGCAAGTTGG + Intergenic
1182186464 22:28408132-28408154 CTGTGCAACTCTTAGGAAGTCGG - Intronic
1182366422 22:29782399-29782421 CTCTCTGACTTTGAGCAAGGTGG - Intergenic
1182516280 22:30860882-30860904 CTGTGTGACTTTCCTGAAGTGGG + Intronic
1182565567 22:31195926-31195948 CTGGGTGACTTTGTGGAGTTTGG + Intronic
1182674320 22:32026133-32026155 CTGTGGGACGTTGAGGCAGGTGG + Intergenic
1183074486 22:35418172-35418194 CTCTATGACTTTGGGCAAGTTGG + Intronic
1183310190 22:37105388-37105410 CTGTGAACATTTGAGGAAGTGGG - Intronic
1183542539 22:38437780-38437802 CTGTATATCTTTGTGGAAGTGGG + Intronic
1184828799 22:46970993-46971015 CTGTGTGCCTTTGCCAAAGTGGG + Intronic
949320174 3:2800919-2800941 CTGGGTAAGTTTCAGGAAGTAGG - Intronic
950298463 3:11852572-11852594 CTGTGTGACCTGGTGCAAGTTGG + Intergenic
950834384 3:15905295-15905317 CCCTGTGACTTTGAATAAGTAGG - Intergenic
951507739 3:23467455-23467477 CTCTATGACTTTGAGCAAATTGG + Intronic
953197192 3:40745710-40745732 CAGTGAGACTTTAAGGAAGATGG - Intergenic
954819226 3:53310752-53310774 CTGTGAGACATTGAAGAATTTGG + Intronic
956279861 3:67544656-67544678 CTGTGAGACTTCTAGGAAGATGG + Intronic
956814549 3:72896136-72896158 CCGCGTGACTTTGAACAAGTCGG + Intronic
956916257 3:73874714-73874736 CAGTGTGACCTTGAGCAAGACGG + Intergenic
957432444 3:80128940-80128962 TTATGTGACTTTGAGCAAGGTGG + Intergenic
959341441 3:105136450-105136472 CAGTGTGCCTTTATGGAAGTGGG + Intergenic
963932843 3:151022149-151022171 CTGGGAGACCTAGAGGAAGTTGG - Intergenic
965011300 3:163095593-163095615 CTGTGTTACCTTGGGCAAGTTGG + Intergenic
965494798 3:169384751-169384773 ATTTGACACTTTGAGGAAGTAGG - Intronic
965729638 3:171757449-171757471 GTGTGTGCCTTTGAGGAGCTGGG - Intronic
966219625 3:177537796-177537818 CAGTGTCACTTTGAGGAGGGTGG + Intergenic
969232864 4:5843616-5843638 CTCTGTGACTTTGGGCAGGTTGG + Intronic
970488785 4:16550753-16550775 ATCTGTGCCTTTGAGGAATTTGG + Intronic
970500514 4:16672207-16672229 CTGTGTGACCTTCAGTGAGTTGG - Intronic
971379363 4:26082988-26083010 CTGGGTGACTTTGATCAAGAAGG - Intergenic
972577552 4:40365622-40365644 CTGTGTCATATTAAGGAAGTTGG - Intergenic
973321569 4:48816101-48816123 CTGTGTGACTAGCAGGAAGAAGG - Intronic
975438310 4:74380146-74380168 CTGAGTTATTTTGAGGAAGCAGG + Intronic
975655230 4:76634801-76634823 TTGTGTGACTTAGAGGAAGAAGG + Intronic
975822359 4:78285002-78285024 CTGTTTGATATTGAGCAAGTTGG - Intronic
976228777 4:82818680-82818702 CTGATTGACACTGAGGAAGTAGG + Exonic
979695687 4:123610677-123610699 CTGTGTGACCTTGGGAAAGTTGG - Intergenic
980181053 4:129401134-129401156 CTGTGTAACGTAGAGGGAGTAGG + Intergenic
981364792 4:143889876-143889898 CTGTGTGAACTTAAGCAAGTCGG - Intronic
981751589 4:148097530-148097552 CTATGTGACTTTTAGCAAGTAGG - Intronic
986270812 5:6229048-6229070 CTGTGGGACTGTTGGGAAGTTGG + Intergenic
986405860 5:7424380-7424402 CTGTGTGACTTTGAGGAAGTTGG - Intronic
986517821 5:8581767-8581789 CTGTTTCACATTGAGGGAGTAGG + Intergenic
988646843 5:33104519-33104541 GTGTGTGACTGTGAAGAAGTTGG + Intergenic
989461148 5:41699810-41699832 TTTTGTGACTGTGAGCAAGTGGG - Intergenic
989777713 5:45229222-45229244 CTTTTTCACTTTGAGGAAGATGG - Intergenic
990344461 5:54857705-54857727 CTCTGTGAATTTCAGGAAGGTGG + Intergenic
992449138 5:76859885-76859907 CTCTGGGACTTTGAGTAAATTGG + Intronic
992565184 5:77988931-77988953 CTGTCTGACTCTGAGCAAGGTGG + Intergenic
993792382 5:92223435-92223457 CTGTGAGACGTTGTGGAAGTGGG + Intergenic
995726838 5:115190427-115190449 CCTAGTGACTTTGAGTAAGTAGG - Intergenic
997215831 5:132109876-132109898 CTCTGGGTCTTTGAGGAAGCAGG + Intergenic
998376299 5:141692961-141692983 CTGTGTGACCTTGGGAAAGCAGG + Intergenic
998457859 5:142287621-142287643 CTGTCTGCCTTTGGGGAAATGGG - Intergenic
998480268 5:142457450-142457472 CTGTGTGACTTTGTGGAAGAAGG - Intergenic
998606185 5:143637182-143637204 CTGTGAGACTTTGAACAATTTGG - Intergenic
998700840 5:144697881-144697903 CTGTGTGGCTTAGGGGAAGATGG + Intergenic
999081866 5:148852094-148852116 CTGAGTGATTTTGAGGAAATTGG + Intergenic
999125335 5:149242064-149242086 CTGTCTGTCTTTGAGGGAGGGGG + Intronic
999778593 5:154830616-154830638 CTGAGTGACTCTGAGGTTGTGGG + Intronic
1000443851 5:161296100-161296122 CTATGTGGCTTTGAGAAATTTGG - Intronic
1000926663 5:167202646-167202668 CTGTGTGACTGGGAGGATGATGG - Intergenic
1000988937 5:167891870-167891892 CTGTGCTGCTGTGAGGAAGTGGG - Intronic
1001107481 5:168867506-168867528 GTGTGTGACTTTGAAGAAGTAGG + Intronic
1001245273 5:170101418-170101440 CTGTTGAACTTTGAGGAAGCAGG - Intergenic
1001297578 5:170509250-170509272 CTTTGTGATTATGAGGGAGTGGG - Intronic
1001326989 5:170736148-170736170 CTGCCTGACTTGGAGGCAGTGGG - Intronic
1003259124 6:4500690-4500712 CTGTGTGACTTTTATTATGTGGG - Intergenic
1003830363 6:10003366-10003388 CTTTGAGATTTTGGGGAAGTGGG - Intronic
1004124757 6:12862416-12862438 CTGGGAGACTGTGAGGAAGGAGG + Intronic
1004859750 6:19790746-19790768 CTGTGTGACCTTGAGAGAGCTGG - Intergenic
1005418914 6:25629333-25629355 CGGTGTGACCTTGAGCTAGTTGG - Intergenic
1005441484 6:25873800-25873822 CTGGGTGACCTGGAGGAAGAGGG - Intronic
1006192370 6:32217446-32217468 CTGTGTGACTTTGGGCAAGCTGG + Intronic
1007250449 6:40491462-40491484 CTGTGTGACTGTGGGTAGGTAGG + Intronic
1007250476 6:40491654-40491676 CTGTGTGACTGTGGGTAGGTAGG + Intronic
1007250529 6:40492048-40492070 CTGTGTGACTGTGGGTAGGTAGG + Intronic
1007392569 6:41558575-41558597 CTTTGTGACATTGAGGAATGAGG - Intronic
1007900137 6:45403763-45403785 ATGTGTGACTTGGGGGAAGAGGG + Intronic
1008711254 6:54230003-54230025 ATGAGTGGCTTTGAGGAAGTAGG - Intronic
1010244113 6:73647070-73647092 ATGTGTTACTTTGAGCAATTTGG + Intronic
1012318585 6:97813808-97813830 CTGTGTGCCTTTTAGGAGGTTGG + Intergenic
1013206227 6:107948335-107948357 CTGTATGACTTTAGGAAAGTTGG + Intronic
1013656007 6:112247268-112247290 CTGTTTGACTTTGGGCAAATTGG - Intronic
1013938816 6:115634922-115634944 CTGTCTGACTTTAAGGCAGGAGG + Intergenic
1017267766 6:152470137-152470159 CTGAGTGAACTTGATGAAGTAGG + Intronic
1018207161 6:161446346-161446368 AAGTGTGACTTAGAGGAACTGGG + Intronic
1018925690 6:168205398-168205420 CTGTATGACCTTGGGGAACTTGG + Intergenic
1019325290 7:435261-435283 CTGTGTGACATGGAGGGAGGTGG - Intergenic
1019852811 7:3576337-3576359 CTGTGTGACTCTGAGCTAGGTGG + Intronic
1020241074 7:6395623-6395645 CTGTGTGACTGTGCTGAAATAGG - Intronic
1021670790 7:23033002-23033024 CTGTGTGACCTTGATCAAGTTGG - Intergenic
1022324787 7:29321455-29321477 CTGGGTGACCTTGGGCAAGTGGG - Intronic
1022460520 7:30601070-30601092 CTGTATGACTTTGGGCCAGTTGG + Exonic
1022514746 7:30968491-30968513 CGGGGTGACTTTGGGCAAGTCGG + Intronic
1022807237 7:33834597-33834619 CAGTGTCACATTGTGGAAGTGGG + Intergenic
1023658304 7:42448403-42448425 TTGTGTGACTGTGTGGAATTAGG + Intergenic
1024035813 7:45506541-45506563 GTGTGTGATTGTGAGGCAGTGGG - Intergenic
1024093755 7:45968293-45968315 TTGTGTGCCTTAGAGGATGTGGG - Intergenic
1024405683 7:48976593-48976615 CAGTCTGACTCTGAGGAAGGTGG - Intergenic
1024920930 7:54553965-54553987 CTGTGTGACGTTGGGAAGGTGGG - Intronic
1026418994 7:70213281-70213303 CTTTGTGAGTCTGAGGCAGTAGG + Intronic
1026870468 7:73848015-73848037 CTTTGTAACTTTGAGTTAGTCGG - Intergenic
1030469533 7:109946322-109946344 CTGTTTGTGTTTGAGGATGTGGG + Intergenic
1030838061 7:114312839-114312861 GTGTGCAACTTTGAGGAATTAGG - Intronic
1032228595 7:130054376-130054398 CTATCAGACTTTGAGAAAGTGGG - Intergenic
1034990358 7:155544126-155544148 CAGTGTGAATTTGAGGAGGGTGG + Intergenic
1035870011 8:3127326-3127348 CTGAGCGACTTTGAGTAATTAGG - Intronic
1038540923 8:28389466-28389488 CTGTGGGAAGTTGAGGCAGTAGG + Intronic
1038651582 8:29408600-29408622 CTGTTTGACACTGAGGAAGTTGG + Intergenic
1038774771 8:30518988-30519010 CCTTGTGACTTTGAGGAAGAAGG + Intronic
1038907374 8:31920668-31920690 CTGTATGACCTTGAGGATGTTGG + Intronic
1039190759 8:34971602-34971624 CTGTGTCACTTACAGGAAGAAGG - Intergenic
1041481219 8:58321553-58321575 CAGGATGACTCTGAGGAAGTTGG + Intergenic
1042110493 8:65376362-65376384 CTGTGTAACTTTGAATAACTTGG - Intergenic
1042534980 8:69849827-69849849 CTGTGTGAATTTGGGCACGTTGG - Intergenic
1043790043 8:84454302-84454324 CTGTGTTTGTTTGAGGAGGTAGG + Intronic
1044537171 8:93370522-93370544 CTGTGTGGCCTTGGGCAAGTTGG - Intergenic
1044680402 8:94772234-94772256 CTGTGTGCTTCTGAGGAAGGGGG - Intronic
1044874137 8:96647600-96647622 CTGTGTGACTTTGAAGAATGTGG + Intronic
1045183561 8:99812916-99812938 CTTTGTGGCTTTGGGGAAGGAGG + Intronic
1045286821 8:100798853-100798875 CTTAGTGACTTGGAGGAGGTGGG - Intergenic
1045835182 8:106512184-106512206 CTGTGTGACCTTGGGCAATTGGG - Intronic
1046151241 8:110229156-110229178 CTGGCTGACTTTGAGGAAAAAGG - Intergenic
1046689082 8:117262687-117262709 CTGTGTGACTTTAAATAATTTGG - Intergenic
1047526478 8:125638329-125638351 CTGTGTGGCTTTGGGGAAACAGG + Intergenic
1049204961 8:141359374-141359396 CTCTCTGACTCTGAGGAAGAAGG - Intronic
1049588336 8:143442047-143442069 CTGTGTGGCTGGGAGGATGTGGG - Intronic
1050283125 9:4073443-4073465 ATGAGTGACTTTCAGAAAGTGGG - Intronic
1050942535 9:11478064-11478086 CTTTGTGAGTTTGAGGCAGATGG + Intergenic
1051228572 9:14929185-14929207 TTGTGTGACCTTGGAGAAGTGGG + Intergenic
1051562129 9:18453687-18453709 CTGTAGGACTTTGGGGAAGGTGG - Intergenic
1051654088 9:19361635-19361657 CAGTGTGACTTTTAAGAAATGGG - Intronic
1052560645 9:30079041-30079063 CTCTGTGACCTTGGGCAAGTGGG + Intergenic
1053458948 9:38253532-38253554 CTTTGTGACTCTGAGGCAGGTGG + Intergenic
1055111540 9:72564819-72564841 CTGTGCCACTTTGTGGAACTGGG + Intronic
1056024271 9:82476406-82476428 CTATGTGAGATTGAAGAAGTGGG - Intergenic
1056182907 9:84102680-84102702 CTGTGTGCCTTTTTGGAAGGCGG + Intergenic
1057217257 9:93235974-93235996 CTGTGTGCCCCTGAGGAAGTGGG + Intronic
1059580548 9:115543266-115543288 CTGTGTCACTTGGACTAAGTAGG - Intergenic
1060075490 9:120587109-120587131 CTGTGTGACTTTGGGAAAATCGG - Intergenic
1060215041 9:121733805-121733827 GTGTGTGACTGTGAGAAAGGCGG + Intronic
1060267739 9:122122087-122122109 CTGTGTGATCTTGGGCAAGTGGG - Intergenic
1060623066 9:125084945-125084967 CTGCGTGACTTTGGGGAAAATGG - Intronic
1060652474 9:125340425-125340447 CTGTGTAACTTTGAGGAAGAGGG + Intronic
1060855133 9:126909019-126909041 CTGTGAGACTCTGAAGAAGAGGG - Intergenic
1061780590 9:132993993-132994015 CTGTGTGACTTTGGGCAAGTAGG - Intergenic
1061860398 9:133465012-133465034 CTGTGTGACATGGAGGAAAGGGG - Intronic
1061874175 9:133535667-133535689 CTGTGTGGCTTTGAGCAGGTTGG + Intronic
1185999302 X:4989924-4989946 CTGTGTGACCTTGAGGACCCAGG - Intergenic
1187125269 X:16448630-16448652 CTGTGTGACCTTGGGCAAGGTGG + Intergenic
1187397098 X:18928189-18928211 CTGTGGGTCCTTGAGGGAGTGGG + Intronic
1188378819 X:29466700-29466722 CTGTGTAACTCTGAGGGAATTGG - Intronic
1188583843 X:31749061-31749083 CTGGCTGTCTTTGGGGAAGTTGG - Intronic
1188935057 X:36165603-36165625 TTGTATGACTTTGAGAAAGCTGG + Intergenic
1190047591 X:47125175-47125197 CTGTGGGACTTGGAGGACATGGG - Intergenic
1190600719 X:52089399-52089421 CTGTGAGGCATTGTGGAAGTGGG + Intergenic
1192100315 X:68257445-68257467 CTGTGTGACCTTGAACAAGTAGG + Intronic
1192845567 X:74903702-74903724 CTGTGTGACTTTGAGCGAGCAGG + Intronic
1196235194 X:113271867-113271889 CTGTATGACTTTGGGCCAGTTGG + Intergenic
1197122900 X:122913480-122913502 GTGTGTGCATTTGAGGAAGTAGG + Intergenic
1197595271 X:128456535-128456557 CTGTATGACTTTGAGCAACATGG - Intergenic
1198182192 X:134220794-134220816 TTGTCTGACTTTGGGTAAGTGGG - Intergenic
1198194089 X:134342606-134342628 CTGTGTGACCTTGAGCAAGTTGG + Intergenic
1199533243 X:148872932-148872954 CTATATGACTTTGAGGGAGGGGG + Intronic
1199665161 X:150090669-150090691 GTATGTGACCTTGAGGAAGCTGG + Intergenic