ID: 986406310

View in Genome Browser
Species Human (GRCh38)
Location 5:7428148-7428170
Sequence AACTGCTGGTAGCAGGTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 152}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986406310 Original CRISPR AACTGCTGGTAGCAGGTTGA TGG Intronic
900438068 1:2640861-2640883 AACTGCAGGGACCAGGTTGCTGG + Intronic
901106862 1:6763197-6763219 TACTTCTGTTTGCAGGTTGATGG - Intergenic
901145895 1:7064507-7064529 AAGTGCTGGGAGGAGGGTGATGG + Intronic
901155589 1:7135654-7135676 AACAGGTGGTAGAAGCTTGAAGG - Intronic
903725581 1:25440993-25441015 AACAGATGGGAGCAGGTTCATGG + Intronic
905284934 1:36873135-36873157 ACGTGCTGGTGGCAGGATGAGGG - Intronic
909798663 1:79777660-79777682 AGATGCTGATAGCAGGCTGAGGG - Intergenic
914323489 1:146587945-146587967 AACTGCTCCTAGCTGATTGACGG + Intergenic
914791302 1:150879595-150879617 AACATCTGGTAGCAGGTACAGGG - Intergenic
915598942 1:156910399-156910421 CCCTGCTGGTGGCAGGTGGAAGG - Intronic
916066126 1:161137144-161137166 AACAGCCTGTAGAAGGTTGAAGG + Intergenic
920164417 1:204025614-204025636 AACTGGTGGGAGCCGGGTGATGG - Intergenic
920462002 1:206147855-206147877 AACAGCTGGTGCCAGGTTCATGG + Intergenic
921176564 1:212600212-212600234 GACTGCTGGTAGAGGGCTGAGGG - Intronic
921234530 1:213112201-213112223 AACTGTTGGTAGAAGGTAGAGGG + Intronic
921785219 1:219221607-219221629 ATCTGCTGGTAGCTGTTTCAAGG + Intergenic
922595605 1:226810512-226810534 AACTGGTGGCAGCAGCTTGGCGG + Intergenic
1062972466 10:1659709-1659731 AACTACTGGAAGCAGCATGATGG - Intronic
1064324812 10:14340145-14340167 AGCTGCTGGTCCCAGGTTGATGG + Intronic
1064826220 10:19405210-19405232 AACTACTGGTAGAATGTAGAAGG + Intronic
1065997111 10:31069552-31069574 AACAGCTGGAAACAGGCTGAGGG - Intergenic
1067213902 10:44284579-44284601 ATCTGGTCTTAGCAGGTTGAGGG - Intergenic
1067821057 10:49530767-49530789 CTCTGCTGGTGGCAGCTTGAGGG + Exonic
1069909465 10:71750688-71750710 AACTGCTGGTAGGAGGCAGCTGG + Exonic
1070706797 10:78645679-78645701 CAATGCTGCTAGCAGGTAGATGG - Intergenic
1071368687 10:84928067-84928089 AAATGCTGGTGGCAGGTCAAGGG + Intergenic
1074160663 10:110834013-110834035 AAAGGCAGGGAGCAGGTTGAAGG + Intronic
1076215263 10:128688141-128688163 TATTGCTGGTGGCAGGTTGCTGG + Intergenic
1078609296 11:12806291-12806313 AACAGCTGTTAGCAGGAGGAAGG - Intronic
1081158084 11:39719160-39719182 AAGGGGTGGTAGCAGGGTGAAGG + Intergenic
1081836588 11:46160414-46160436 CACTGCTGCCAGCAGGTGGAGGG - Intergenic
1083541620 11:63515542-63515564 AACTGCAGGAAGCAGGAGGAAGG - Exonic
1085578095 11:77625318-77625340 GACTGCTGGCATCAGGGTGAAGG + Intronic
1088973437 11:114793635-114793657 AATTGCAGGTTGCATGTTGAAGG + Intergenic
1089749530 11:120640793-120640815 AACTGCTGGAACCAGGGAGATGG - Intronic
1090474242 11:127005040-127005062 AACTGCAGGGAGCAGGGTTAAGG - Intergenic
1090744094 11:129693049-129693071 GACTGCTGGGAGCATGGTGAGGG - Intergenic
1091687917 12:2576834-2576856 CTTGGCTGGTAGCAGGTTGAGGG - Intronic
1091741169 12:2961027-2961049 AAAAGCTGGTAGGAGGCTGAAGG + Intronic
1094441831 12:30486270-30486292 GACTGGTGGGAGCAAGTTGAAGG + Intergenic
1095132316 12:38558839-38558861 AAATGATGGTAGCAGTTTGTAGG - Intergenic
1095708309 12:45261416-45261438 AACTGCTGTTAGCACGCTCAGGG + Intronic
1096394751 12:51257340-51257362 AAATGCAGGTGGCAGGTTGATGG + Intronic
1098589979 12:72199483-72199505 AACCTGTGGTAGCATGTTGAAGG + Intronic
1099310715 12:81018269-81018291 AACAGTTAGAAGCAGGTTGAAGG - Intronic
1105782274 13:23715599-23715621 GACTGCTGGCGGCAGGGTGATGG + Intergenic
1107435512 13:40377501-40377523 GACTGCCGGCAGCAGGTTGCAGG - Intergenic
1109925242 13:69128258-69128280 AACTGCCGGTAGCTGAGTGAAGG + Intergenic
1116140711 14:40991107-40991129 TAATGCAGGTGGCAGGTTGATGG - Intergenic
1118049332 14:62009729-62009751 AACTGCTGATAGCAGAGTGAGGG - Intronic
1119358677 14:74029009-74029031 AACTGGCAATAGCAGGTTGAAGG + Intronic
1121358708 14:93235594-93235616 AACAGGTGGAAGCAGGTTCAAGG - Intergenic
1123153018 14:106200705-106200727 AACTGCCGGTAGCAGGTTTATGG + Intergenic
1124431486 15:29612476-29612498 CTCTGCTGGTAGCAGGCTGAAGG - Intergenic
1126119050 15:45234825-45234847 AACAGGTGGTAGCAGGTTTCAGG + Intergenic
1127884391 15:63186749-63186771 TACTTCAGGTAGCAGGTTGCTGG - Intergenic
1128313836 15:66647714-66647736 AACTGCTGGGATCAGGTGGAGGG - Intronic
1132710564 16:1265316-1265338 AGCTGCTGGTAGCATGGAGAAGG - Intergenic
1136045342 16:27610676-27610698 AACTGCTGGTTGTTGGTTGGGGG - Intronic
1140010073 16:71122905-71122927 AACTGCTCCTAGCTGATTGACGG - Intronic
1140327512 16:74019365-74019387 AAGTGCTGATACCAGGTAGATGG - Intergenic
1144074250 17:11702634-11702656 AACTGTTGGTAGCAGGTAAGAGG + Intronic
1144217925 17:13072906-13072928 AGCTGCTGGGAGCATTTTGAGGG + Intergenic
1145034698 17:19533091-19533113 AACGGCTGGTGCCAGGCTGAGGG + Intronic
1145240497 17:21238280-21238302 TACTCCTGGTAGAAAGTTGATGG - Intergenic
1145924956 17:28639893-28639915 AACTGCTGCTGGAAGGTTCATGG - Exonic
1147855937 17:43480023-43480045 TATTGCTGATGGCAGGTTGATGG + Intergenic
1150505723 17:65696710-65696732 AACTGCTTGAAGCGGGGTGATGG + Intronic
1152527110 17:80894609-80894631 CACTGCTGGTAACAGATTTAGGG + Intronic
1154341500 18:13506191-13506213 AACAGCTGCTCGCAGGTTGGTGG - Intronic
1157627050 18:49059798-49059820 AATGGCTTGTAGCTGGTTGATGG - Intronic
1159038429 18:63299485-63299507 TACTGCTGGTAGCAGTGTGTTGG - Intronic
1159141958 18:64407969-64407991 TTCTGCTGGTAGTAGGTTGGAGG + Intergenic
1159628869 18:70726294-70726316 AACTCATGGTAGAAGGTGGAAGG + Intergenic
1159926605 18:74275387-74275409 AACTCCAGGCAGCAGGATGAAGG - Intronic
1164309944 19:24036812-24036834 CATTGGTGGTAGCAGGTTGAGGG - Intronic
1164681818 19:30139606-30139628 AAGTGCTGGTGGCAGCTTGCGGG + Intergenic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
925321116 2:2969706-2969728 AAAGGGTGGGAGCAGGTTGAGGG - Intergenic
925837104 2:7956793-7956815 AACTGCTTTTAGGAAGTTGATGG + Intergenic
928214496 2:29350054-29350076 AACTGCTGCTCTCAGGGTGAAGG + Intronic
942516783 2:176762396-176762418 CACTGCTGCTAGTGGGTTGAGGG - Intergenic
945400965 2:209382388-209382410 AACTCCTGGTAGGGGGATGAAGG + Intergenic
946546229 2:220747171-220747193 AGCTGCTGGGTGGAGGTTGAAGG - Intergenic
948681202 2:239635843-239635865 AACTGCTGCTGACAGCTTGATGG + Intergenic
1169163512 20:3403441-3403463 AAATGCTGGTAGCTTGTTGGTGG - Intronic
1173338621 20:42134481-42134503 AACTGGTGGCAGAAGGTAGAAGG + Intronic
1173653407 20:44682337-44682359 CACAGCTGGTAGCAGGTGCAGGG - Intergenic
1173734560 20:45350006-45350028 CATTGGTGGGAGCAGGTTGAGGG + Intergenic
1175358871 20:58391272-58391294 AAGTACTGGGAGGAGGTTGAGGG - Intronic
1176658855 21:9614582-9614604 TCCTGCTGCTAGCAGGCTGAGGG - Intergenic
1177110646 21:17023679-17023701 AACTGCCTGTAGAGGGTTGAAGG - Intergenic
1177812491 21:25939199-25939221 AGCTGTTGGCAGCAGGATGAAGG + Intronic
1178067020 21:28915846-28915868 AACTGCGGATAGCAAGTTAATGG - Intergenic
1178589668 21:33898682-33898704 CACCGCTGGTGGAAGGTTGAGGG + Exonic
1179500427 21:41805216-41805238 AACTGCTGTAAGCAGGGTGTGGG - Intronic
1183273175 22:36874615-36874637 AACTTCTGGCCTCAGGTTGAAGG + Intronic
1185292750 22:50035353-50035375 ACCTGCTGGGGGCAGCTTGAAGG + Intronic
950235807 3:11319383-11319405 AAGTGCTGGTAGGAGGAGGAGGG - Intronic
950291699 3:11789786-11789808 GACTGCTGGCAGCAGCTTCAAGG - Intergenic
953144170 3:40258551-40258573 AACTGCTGGAGGGAGGTGGAGGG + Exonic
954489961 3:50894249-50894271 ATCTGCTGATAGCAGATTTATGG - Intronic
954798999 3:53176165-53176187 ACCTGCTGGTGTCAGGCTGAAGG + Intronic
956735497 3:72234500-72234522 AACTGCTGCTTACAGGCTGAAGG - Intergenic
959044493 3:101457636-101457658 AACTGCTCGTAGAAGGAAGAAGG - Intronic
961815817 3:129549506-129549528 AACTCATGGTAGCTGGTTGGGGG + Intronic
966780068 3:183576561-183576583 AACTGCAGGAAGCAGCTTGTAGG + Intergenic
967706592 3:192658407-192658429 AACTGCTGGTAGCAGCATTTAGG - Intronic
973578398 4:52315692-52315714 AATTGCAGTTAGAAGGTTGAAGG + Intergenic
975033138 4:69648842-69648864 AACTGCTGGTAGCAGTCTTAAGG + Intronic
975362432 4:73486622-73486644 ACCAGCTGGTAGCATGTGGATGG + Intronic
975590207 4:75992145-75992167 AACAGCTGGTAGCTGGTTGCTGG + Intergenic
976176136 4:82354085-82354107 AACTGCTATTAGCAGGTGGCAGG + Exonic
977377300 4:96222191-96222213 GTCTGCTGGTAGGAGGGTGATGG - Intergenic
979026840 4:115588160-115588182 AGCTGATGGTAGAAAGTTGAAGG - Intergenic
984611554 4:181844861-181844883 AACTGTTAGCAGCAGGCTGAGGG - Intergenic
984757494 4:183337804-183337826 ACCTTCTGGAAGGAGGTTGAGGG - Intergenic
985519907 5:369310-369332 AACAGCTGGTACCAGGTTAGGGG - Intronic
986406310 5:7428148-7428170 AACTGCTGGTAGCAGGTTGATGG + Intronic
988197026 5:28016675-28016697 AAATCCTGCTAGCAGGCTGAGGG + Intergenic
988412785 5:30908608-30908630 ATCGGCTGGTAGCAGCTTGGGGG + Intergenic
994368993 5:98947820-98947842 AAATGCTGGAAGAAGGTTGTGGG + Intergenic
999503638 5:152172158-152172180 AACTTCTGGCAGCAGTTTGCAGG + Intergenic
1006083115 6:31578896-31578918 AACAGCTGGAAACTGGTTGAAGG - Intergenic
1006737183 6:36282585-36282607 ACCTGCTGATACCAGGTGGATGG - Intronic
1010340685 6:74748776-74748798 TACTGCTTTTAGCAGGTTAAAGG - Intergenic
1010551858 6:77233016-77233038 AACTGTGGATAGCAGGTTGAGGG - Intergenic
1013815983 6:114098276-114098298 AACTTCAGTTACCAGGTTGAAGG - Intronic
1019624241 7:2007904-2007926 AACTGCTGATACAACGTTGATGG + Intronic
1019739646 7:2666217-2666239 AGCTGCTGGTGGCAGGAGGAAGG - Intergenic
1024977087 7:55123583-55123605 AATTGCTGGCAGCAGCTTGAGGG + Intronic
1028532005 7:91848653-91848675 AACAGGTGGTAGCAGTTGGAGGG - Intronic
1028567412 7:92247888-92247910 AACTGCTGAAAGGAGGTTGGGGG - Intronic
1029268710 7:99363075-99363097 AAATGCTGGGAGCAGGTTGTGGG - Intronic
1029907264 7:104104364-104104386 AACTCCTGGCAGAAGGGTGAAGG - Intergenic
1030532394 7:110727546-110727568 AACTGATGTTAGCAAATTGAAGG + Intronic
1032250764 7:130255440-130255462 AATTACTGGTAGCTGGGTGAAGG - Intergenic
1032498764 7:132383478-132383500 AACTACTGTTAGCATTTTGATGG + Intronic
1033669057 7:143472374-143472396 AACTGGTGGGAGCAGGTTTCAGG - Intergenic
1037194103 8:16166600-16166622 CACTGGTGGTAGCATGTGGAGGG - Intronic
1037884279 8:22588249-22588271 AACTGCTGGTAGCAGCCTGGTGG + Intronic
1038280941 8:26164130-26164152 CACAGCTGGTAGCCTGTTGAAGG - Intergenic
1038955031 8:32458677-32458699 AACTGCTGGGAGAAGGGAGAGGG - Intronic
1041036551 8:53797321-53797343 AACTGCTGCTGCCGGGTTGAAGG - Intronic
1041443177 8:57920398-57920420 AACTCCTGGCAGCTGGTGGAAGG + Intergenic
1044379397 8:91516330-91516352 AACTGGTGGTAGCAGGTGCAGGG - Intergenic
1048102226 8:131365184-131365206 AGCTCCTGGTGGCAGGTTGGGGG + Intergenic
1048457102 8:134588088-134588110 TACTGTTTGTAGCTGGTTGATGG + Intronic
1050176038 9:2870218-2870240 AACAGATGGTAGCAGGTGAAAGG + Intergenic
1050734188 9:8744648-8744670 AAAGGCTGGCAGCAGGGTGAGGG + Intronic
1052240306 9:26264144-26264166 AAATGCTGGGACCAAGTTGAGGG + Intergenic
1052378379 9:27742426-27742448 CACTGCTGGTAGCTGGTTGTGGG + Intergenic
1054734253 9:68734515-68734537 GACTGCTGGTAGCAGGCAGATGG + Intronic
1055006380 9:71512146-71512168 ACCTAATGGTAACAGGTTGATGG - Intergenic
1057219064 9:93246051-93246073 CACTGCTGGTATCAGGTGGGGGG - Intronic
1057453340 9:95185572-95185594 AACTGTTGGAAGCAAGTTGTTGG - Intronic
1057474914 9:95390561-95390583 AACTGTTGGAAGCAAGTTGTTGG + Intergenic
1057614082 9:96572380-96572402 ACCTGGAGATAGCAGGTTGAGGG - Intronic
1058639436 9:107068637-107068659 AACTGCAGGTAGGGTGTTGATGG - Intergenic
1059889630 9:118786950-118786972 AACTGCAGATACCAGGCTGAGGG + Intergenic
1061185853 9:129052749-129052771 CACAGCTGGTAACAAGTTGAAGG + Intronic
1203636601 Un_KI270750v1:118189-118211 TCCTGCTGCTAGCAGGCTGAGGG - Intergenic
1187111779 X:16309347-16309369 AACTGCTGCTACCAGAATGAAGG - Intergenic
1187187812 X:17003882-17003904 AAGTTCTGGAAGAAGGTTGAAGG - Intronic
1188529472 X:31123542-31123564 AACTGCTGCTATCAAGTTGGAGG + Intronic
1189719909 X:43905429-43905451 ACCAGTTGGTAGCAGGTGGAAGG + Intergenic
1191701313 X:64045357-64045379 AACTGCTATTAGCAGGTGGCAGG - Intergenic
1191714738 X:64186580-64186602 AGCTGCTGGCAGCAGGATGAAGG + Exonic
1191904187 X:66071434-66071456 CACTGCTGCCAGCAGGATGAAGG + Intergenic
1192682499 X:73266780-73266802 AAGTGGTGGTCACAGGTTGAGGG + Intergenic
1197114497 X:122817390-122817412 CACTGCTGGTAGCCGGCAGATGG + Intergenic
1200846632 Y:7837345-7837367 AACTGCTGGCAGCAGGTTTATGG - Intergenic