ID: 986409645

View in Genome Browser
Species Human (GRCh38)
Location 5:7464533-7464555
Sequence CAAGCTACCCCCAATCTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 81}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986409645_986409652 30 Left 986409645 5:7464533-7464555 CCACCTAGATTGGGGGTAGCTTG 0: 1
1: 0
2: 1
3: 5
4: 81
Right 986409652 5:7464586-7464608 AGGTCAGTTCACCTCAGCTTAGG No data
986409645_986409648 -2 Left 986409645 5:7464533-7464555 CCACCTAGATTGGGGGTAGCTTG 0: 1
1: 0
2: 1
3: 5
4: 81
Right 986409648 5:7464554-7464576 TGTTATGCAGCAGTAGATAAGGG 0: 2
1: 3
2: 13
3: 63
4: 279
986409645_986409649 -1 Left 986409645 5:7464533-7464555 CCACCTAGATTGGGGGTAGCTTG 0: 1
1: 0
2: 1
3: 5
4: 81
Right 986409649 5:7464555-7464577 GTTATGCAGCAGTAGATAAGGGG 0: 1
1: 5
2: 18
3: 78
4: 261
986409645_986409650 10 Left 986409645 5:7464533-7464555 CCACCTAGATTGGGGGTAGCTTG 0: 1
1: 0
2: 1
3: 5
4: 81
Right 986409650 5:7464566-7464588 GTAGATAAGGGGAACCAATAAGG No data
986409645_986409647 -3 Left 986409645 5:7464533-7464555 CCACCTAGATTGGGGGTAGCTTG 0: 1
1: 0
2: 1
3: 5
4: 81
Right 986409647 5:7464553-7464575 TTGTTATGCAGCAGTAGATAAGG 0: 1
1: 2
2: 6
3: 28
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986409645 Original CRISPR CAAGCTACCCCCAATCTAGG TGG (reversed) Intronic
902455883 1:16533822-16533844 CAAGCAACTCTCAATCTAGCTGG + Intergenic
902496287 1:16874090-16874112 CAAGCAACTCTCAATCTAGCTGG - Intronic
906387017 1:45378683-45378705 CAAGCTACCCCAAAACTTAGTGG - Intronic
915994324 1:160548500-160548522 CCAGCTACCCCCCATTTGGGAGG + Intronic
919268354 1:195304178-195304200 CAACCAACCCTCAATCTGGGTGG + Intergenic
921291293 1:213660144-213660166 AAAGCTACCCTCTCTCTAGGAGG + Intergenic
1068435836 10:56989969-56989991 GAAGCTACCACCAATATTGGGGG + Intergenic
1068626696 10:59256783-59256805 CAGGATACCCCAAATCTAAGGGG + Intronic
1069770579 10:70896764-70896786 CAAGTAACCCCCAATCTCAGTGG + Intergenic
1074283558 10:112076712-112076734 AGAGCCACCCTCAATCTAGGTGG + Intergenic
1075594510 10:123718651-123718673 CAAGCTACCCCAAAACTCAGTGG + Intronic
1076230513 10:128816678-128816700 CAAGCAAGCCCCAAGCTAGAGGG + Intergenic
1077081401 11:726136-726158 CAAGCTACCCCCAAGCTTCCCGG + Exonic
1078093936 11:8284940-8284962 CAAGTTGCCCACAATCTTGGGGG - Intergenic
1080123427 11:28703328-28703350 CAAGAAACCTCCAATCTAGTGGG - Intergenic
1085320391 11:75570501-75570523 CAATCTACCCCATATCTGGGGGG - Intronic
1086170914 11:83835647-83835669 CAAGTTACCACAAATCTAGCAGG + Intronic
1089153235 11:116380819-116380841 CCAGCTGAACCCAATCTAGGTGG + Intergenic
1090174962 11:124640507-124640529 CAAGCTACCCCAAAACTTAGGGG - Intronic
1092111155 12:5965718-5965740 ACAGCTACCCCCAACCCAGGAGG + Intronic
1102740845 12:115206189-115206211 CAAACTACCCCCAAACTTAGTGG - Intergenic
1104064258 12:125293825-125293847 CAAGCCAGCCCCAATTCAGGGGG - Intronic
1105389105 13:19958877-19958899 CCAGCCACCCCCACTCTCGGCGG - Intronic
1107312046 13:39089814-39089836 CTAGCTACCTGCAATCTAGCTGG + Intergenic
1109776584 13:67048722-67048744 TAAGCTGCCCACAATCTAGTGGG - Intronic
1115591511 14:34870105-34870127 CAACCTACCCCAAAACTTGGTGG - Intronic
1119670660 14:76515758-76515780 CAAGCTACCTCCCAGCTGGGAGG + Intergenic
1121267841 14:92615835-92615857 CAAGCTACCTCCCATGAAGGGGG - Intronic
1122517502 14:102319235-102319257 CAAGGTGCACCCAATCTGGGTGG + Intronic
1127866713 15:63039456-63039478 CAAACAACCCCCAATCTCAGTGG + Intergenic
1129234852 15:74217952-74217974 CAACATACCCACAATCTAGTGGG - Intergenic
1133626450 16:7574664-7574686 CAACCCACCCTCAATCTGGGTGG - Intronic
1134491613 16:14700149-14700171 CCAGCTACTCCCAACCTGGGAGG - Intergenic
1134496994 16:14739267-14739289 CCAGCTACTCCCAACCTGGGAGG - Intronic
1141166745 16:81665982-81666004 GAATTTACCCCAAATCTAGGAGG - Intronic
1155027849 18:21958427-21958449 CAAGGTGCCCCCAGTCTAGTGGG - Intergenic
1157005273 18:43575637-43575659 CATTCTACCCCCAATCTGGGTGG - Intergenic
1158519832 18:58162616-58162638 CAAGCAACCCACCATCTAGTAGG - Intronic
1166063038 19:40338996-40339018 AGAGCTACCCCCAACCTACGTGG - Intronic
928076270 2:28267519-28267541 CAAGCAACCCCCAGTCTCTGTGG + Intronic
929264985 2:39908664-39908686 CAAGTTACCCCAAATCTTAGTGG + Intergenic
941302922 2:163827208-163827230 CAATCCACCCCAAATTTAGGTGG - Intergenic
944021525 2:195111085-195111107 AAACCCACCCTCAATCTAGGTGG + Intergenic
947895860 2:233671429-233671451 CAGGCGAGCCCCAATTTAGGAGG + Intronic
948894407 2:240921638-240921660 CAAGTTACCCCCAAGACAGGCGG + Intronic
1170811021 20:19674733-19674755 TAAGCTACCCCAACTCCAGGAGG - Intronic
1170869553 20:20192570-20192592 CAAGCTACTCCCACTCTAAGAGG - Intronic
1171430854 20:25082360-25082382 CACCCCACCCCCATTCTAGGAGG + Exonic
1172697611 20:36833302-36833324 CCAGCTACCCTCAAGGTAGGGGG + Intronic
1173505460 20:43583645-43583667 CAAGCAACTCCAAAGCTAGGTGG + Intronic
1179553317 21:42156952-42156974 CCAGCTGCCCGCATTCTAGGAGG - Intergenic
1181863669 22:25838712-25838734 CATGCTAACCCCAACCTAGATGG - Intronic
1183007861 22:34918386-34918408 CAAACTACCCCCAAACTCTGTGG + Intergenic
951707830 3:25561402-25561424 CAAACTACCCCCAAGCTCAGTGG + Intronic
953623506 3:44552348-44552370 GAAGCCACACCTAATCTAGGTGG + Intergenic
962003023 3:131319560-131319582 CAAGTTACCACCACTCTAGTTGG - Intronic
967933412 3:194707126-194707148 CAAGATACCCCCAAAGTAGGGGG - Intergenic
976962187 4:90991288-90991310 CAAATTACCCACAAACTAGGTGG + Intronic
979187669 4:117818782-117818804 CAACCCACCCTCAATCTGGGTGG + Intergenic
981429169 4:144640748-144640770 CAAGGTACCACAAAACTAGGTGG - Intergenic
986409645 5:7464533-7464555 CAAGCTACCCCCAATCTAGGTGG - Intronic
987107619 5:14656058-14656080 AGAGCCACCCTCAATCTAGGTGG - Intergenic
988682854 5:33501160-33501182 CAAACTACCCCAAAACTTGGTGG + Intergenic
990720321 5:58687666-58687688 TAAGCTACCTCCTCTCTAGGTGG - Intronic
998211494 5:140202472-140202494 CAAACCACCCCCAATCTTAGAGG + Intronic
1002315127 5:178338522-178338544 GGAGCTACCCCCATTCTTGGGGG - Intronic
1005265705 6:24109978-24110000 CGACCCACCCCCAGTCTAGGTGG - Intergenic
1005641057 6:27796716-27796738 CAAGCTAGCCCCAAACTTGATGG - Intergenic
1006878807 6:37321413-37321435 CTAGCAACCTCCAATGTAGGGGG - Intronic
1010471439 6:76233130-76233152 CCAGCTACCACCAATATATGGGG - Intergenic
1012732841 6:102903657-102903679 CAAACTACCCCAAATCTTAGTGG - Intergenic
1012781091 6:103558495-103558517 CAAGCAACCCGCCATCTAAGTGG + Intergenic
1018396082 6:163379063-163379085 CAAGCCTCCCCCAATCTTGGAGG - Intergenic
1028144193 7:87304041-87304063 AAAGCTACCCTCAGTCTTGGTGG + Intergenic
1030024597 7:105310970-105310992 CAGACAACCCACAATCTAGGAGG + Intronic
1032535096 7:132656598-132656620 CAACCCACCCTCAATCTTGGTGG + Intronic
1037851836 8:22337094-22337116 CAAACTTCCCCCAAAATAGGAGG + Intronic
1038008684 8:23457239-23457261 CAAGCTCCGCCCATTCGAGGGGG + Intronic
1038156510 8:24996464-24996486 CAAGTGACCCCAAACCTAGGAGG - Intergenic
1039131726 8:34272493-34272515 AAACCTACCCTCAATCTGGGTGG - Intergenic
1042664614 8:71191933-71191955 AAGGATACCCACAATCTAGGGGG - Intergenic
1046943794 8:119956149-119956171 CAAGCTACTCCCAAACTTGGTGG - Intronic
1048010817 8:130454586-130454608 CAAACTATCCCCAAACTAAGTGG + Intergenic
1189355909 X:40309798-40309820 CAAGCTACCCCCAAACTAAGTGG - Intergenic
1192882681 X:75303797-75303819 CAAGCAACCTCCAAACTAAGAGG - Exonic
1196558260 X:117117171-117117193 CAACCCACCCTCAATCTGGGTGG - Intergenic
1199135162 X:144241537-144241559 CAAGCAACCTCCAATGTTGGTGG + Intergenic
1199590055 X:149459219-149459241 CAAACTACCCCCAAACTTAGTGG - Intergenic