ID: 986411845

View in Genome Browser
Species Human (GRCh38)
Location 5:7488806-7488828
Sequence GTGGGCTGGGCACTGACGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 204}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986411845_986411850 -6 Left 986411845 5:7488806-7488828 CCCCTCGTCAGTGCCCAGCCCAC 0: 1
1: 0
2: 2
3: 22
4: 204
Right 986411850 5:7488823-7488845 GCCCACAACACCAAGATTCCTGG 0: 1
1: 0
2: 0
3: 9
4: 118
986411845_986411854 0 Left 986411845 5:7488806-7488828 CCCCTCGTCAGTGCCCAGCCCAC 0: 1
1: 0
2: 2
3: 22
4: 204
Right 986411854 5:7488829-7488851 AACACCAAGATTCCTGGGAGAGG 0: 1
1: 0
2: 2
3: 23
4: 176
986411845_986411852 -5 Left 986411845 5:7488806-7488828 CCCCTCGTCAGTGCCCAGCCCAC 0: 1
1: 0
2: 2
3: 22
4: 204
Right 986411852 5:7488824-7488846 CCCACAACACCAAGATTCCTGGG No data
986411845_986411857 25 Left 986411845 5:7488806-7488828 CCCCTCGTCAGTGCCCAGCCCAC 0: 1
1: 0
2: 2
3: 22
4: 204
Right 986411857 5:7488854-7488876 AAGCTGCAGATCTCCTCCTCAGG 0: 1
1: 0
2: 2
3: 13
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986411845 Original CRISPR GTGGGCTGGGCACTGACGAG GGG (reversed) Intronic