ID: 986411845

View in Genome Browser
Species Human (GRCh38)
Location 5:7488806-7488828
Sequence GTGGGCTGGGCACTGACGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 204}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986411845_986411852 -5 Left 986411845 5:7488806-7488828 CCCCTCGTCAGTGCCCAGCCCAC 0: 1
1: 0
2: 2
3: 22
4: 204
Right 986411852 5:7488824-7488846 CCCACAACACCAAGATTCCTGGG No data
986411845_986411857 25 Left 986411845 5:7488806-7488828 CCCCTCGTCAGTGCCCAGCCCAC 0: 1
1: 0
2: 2
3: 22
4: 204
Right 986411857 5:7488854-7488876 AAGCTGCAGATCTCCTCCTCAGG 0: 1
1: 0
2: 2
3: 13
4: 154
986411845_986411854 0 Left 986411845 5:7488806-7488828 CCCCTCGTCAGTGCCCAGCCCAC 0: 1
1: 0
2: 2
3: 22
4: 204
Right 986411854 5:7488829-7488851 AACACCAAGATTCCTGGGAGAGG 0: 1
1: 0
2: 2
3: 23
4: 176
986411845_986411850 -6 Left 986411845 5:7488806-7488828 CCCCTCGTCAGTGCCCAGCCCAC 0: 1
1: 0
2: 2
3: 22
4: 204
Right 986411850 5:7488823-7488845 GCCCACAACACCAAGATTCCTGG 0: 1
1: 0
2: 0
3: 9
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986411845 Original CRISPR GTGGGCTGGGCACTGACGAG GGG (reversed) Intronic
900158937 1:1214263-1214285 GTGGGCTGGGCACAAAGGCGGGG + Intergenic
900396225 1:2454259-2454281 GTGGGCGGGGCACTGGCCATCGG - Intronic
901152509 1:7113274-7113296 GTGGGCTGGTCACTGCCATGTGG + Intronic
901790777 1:11652826-11652848 GTGGGTTGGGCAGGGAGGAGAGG - Intronic
901960975 1:12826418-12826440 GTGAAGTGGGCACTGAAGAGGGG - Intronic
901967572 1:12881022-12881044 GTGAAGTGGGCACTGAAGAGGGG - Intronic
901975370 1:12940153-12940175 GTGAAGTGGGCACTGAAGAGGGG - Intronic
901982975 1:13051284-13051306 GTGAAGTGGGCACTGAAGAGGGG - Intronic
901999115 1:13177634-13177656 GTGAAGTGGGCACTGAAGAGGGG + Intergenic
902009805 1:13261612-13261634 GTGAAGTGGGCACTGAAGAGGGG + Intronic
902017603 1:13320763-13320785 GTGAAGTGGGCACTGAAGAGGGG + Intronic
902030663 1:13419765-13419787 GTGAAGTGGGCACTGAAGAGGGG + Intronic
904370529 1:30045024-30045046 CTGGTCTGGGCACTGAGGACTGG - Intergenic
904645412 1:31962175-31962197 GTGTGCTGAGCACAGAAGAGGGG + Intergenic
904783078 1:32964921-32964943 GTGCGCTGGGCAGGGCCGAGCGG + Intergenic
905344860 1:37304443-37304465 GTGGGCTGGGAAATGATGAATGG + Intergenic
905632284 1:39525386-39525408 GTGGGCAGGGCACTAATGAGGGG - Intronic
906125956 1:43427083-43427105 GGGGGCTGGGCAGAGATGAGAGG - Exonic
908983277 1:69984563-69984585 GTGGGCGGGACACGGACTAGAGG - Intronic
920228407 1:204454633-204454655 GTGGCCTGGGCACTGAAGCCTGG + Intronic
922701119 1:227761692-227761714 GTGGTGTGGGGACTGAAGAGGGG + Intronic
922993968 1:229941350-229941372 CTGGGCTGGGAACTGATAAGAGG + Intergenic
923340236 1:233000557-233000579 GTGGGCTGGGCAAGGACCAGAGG + Intronic
923676643 1:236086263-236086285 GTGGGCAGGGGAATGACGATTGG + Intergenic
923744424 1:236686874-236686896 GTGGCCTGGCGACTGGCGAGAGG + Intronic
1069823901 10:71243657-71243679 GTGGGGTGGCCTCTGAGGAGGGG - Intronic
1069829008 10:71271430-71271452 GAGGCCTGGGCCCTGAGGAGGGG - Intronic
1069918095 10:71799373-71799395 GTGGGCTGGGCACTCCCAGGGGG - Intronic
1070257039 10:74821832-74821854 GTGTGCTGGGCACAGACAAGTGG + Intergenic
1073596257 10:104803438-104803460 GTGGGCTGAGCACTGAGCATTGG + Intronic
1074792990 10:116910852-116910874 GTGGGATTAGCACTGAAGAGAGG - Intronic
1076456934 10:130606689-130606711 GGGGGCTGGGCACTGCAGCGGGG - Intergenic
1076545783 10:131245001-131245023 GTGTGCTGGGCACAGGGGAGTGG + Intronic
1076574264 10:131453529-131453551 GTGGCCTGGGCCCTGAGGGGAGG + Intergenic
1078524504 11:12090328-12090350 GTGGGCAGGGCTCTGACAGGAGG - Intergenic
1078579771 11:12529329-12529351 GGGGGGTGGGCAGTGACTAGGGG + Exonic
1080231542 11:30021797-30021819 GAGGGCTGGGCCCTTACGAATGG - Intergenic
1080392832 11:31864368-31864390 GTGAGATGGGGACTGAAGAGAGG + Intronic
1081412034 11:42771043-42771065 GGGGGCTGGGGACTGAAGAGGGG - Intergenic
1081771712 11:45654331-45654353 GTGGCCTGGACACCGAGGAGGGG + Intronic
1089226223 11:116924786-116924808 GTGGGCTGGTCAGTGCAGAGTGG + Intronic
1089378664 11:118012540-118012562 ATGGGCTGGGCACGGGGGAGTGG - Intergenic
1091319669 11:134640692-134640714 GTGCGGTGGGCACTGAGCAGGGG + Intergenic
1094353232 12:29549757-29549779 GTGTACAGGGCACTGAGGAGGGG + Intronic
1094358137 12:29600699-29600721 GTGGTCTGGGGGCTGACGAAAGG - Intronic
1096262131 12:50099560-50099582 GAGGGCTGGGGACTGACCTGGGG - Exonic
1096487581 12:51994190-51994212 GAGGGCTGGGCAGAAACGAGAGG - Exonic
1096870548 12:54589632-54589654 ATGTGCTGGGCACTGGGGAGGGG + Intergenic
1101961823 12:109256444-109256466 GTGGCCTGGGGACTGACTACAGG - Intronic
1103733430 12:123043445-123043467 CTGGCCTGGGCAGTGAAGAGGGG + Intronic
1104727701 12:131088019-131088041 GTGGGCCGGGCCCTGGCGGGAGG - Intronic
1105050802 12:133048952-133048974 GTTGGCTGGTCAGTGACGGGTGG + Intronic
1108243581 13:48492608-48492630 GAGGACTGAGAACTGACGAGTGG - Intronic
1109915899 13:68984825-68984847 GGCGGCTGGGGACTGACGCGTGG + Intergenic
1113585644 13:111462370-111462392 ATGGGCTGGACACTGATGGGAGG + Intergenic
1116804676 14:49481305-49481327 TTGGGCTGGGCTCTGATGGGTGG - Intergenic
1116863800 14:50015439-50015461 GTGGGGTGAGAACTGAGGAGAGG - Intergenic
1117243786 14:53862739-53862761 GTGGGCTAGGCAGTGGAGAGGGG + Intergenic
1120923769 14:89778522-89778544 GTGGGGTGGGCACTGGTGAGGGG - Intergenic
1121405223 14:93715700-93715722 GTGGGGTGAGCAGTGAGGAGTGG + Intergenic
1121584879 14:95056563-95056585 GTACGCTGGGGTCTGACGAGTGG - Intergenic
1122743944 14:103887223-103887245 CTGGGCTGGACACTGTGGAGGGG + Intergenic
1122836847 14:104434723-104434745 GAGGGCTGGGGACTGAACAGAGG + Intergenic
1122852809 14:104546118-104546140 GTGGGCAGGGCACTGACGGGCGG - Intronic
1122924928 14:104895108-104895130 GCTGGCTGGGAGCTGACGAGGGG - Exonic
1124218068 15:27825789-27825811 GTGGGCTGGGCACTGGCATGGGG - Intronic
1124438443 15:29670186-29670208 GGGGGCTGGGGACTGAAGGGAGG + Intergenic
1125300978 15:38252929-38252951 CTTGGCTGGGCACTGAGGCGGGG + Exonic
1127372631 15:58355364-58355386 GGGGGCTGGGCACTGCCTAGTGG - Intronic
1129394058 15:75234756-75234778 GTGGGCTGGGCCTGGACCAGGGG - Intergenic
1129704536 15:77786732-77786754 CTGGGCTGGCCACTGAGGGGAGG + Intronic
1132722895 16:1325729-1325751 GTGACCTGGCCACTGAAGAGGGG - Exonic
1133030572 16:3008882-3008904 GTGGGTTGGTCACTGAGGTGGGG + Intergenic
1134056595 16:11174045-11174067 GGACGCTGAGCACTGACGAGGGG - Intronic
1134141065 16:11719886-11719908 TTGGGCTGGGCCCTGACAGGTGG + Intronic
1137626795 16:49914173-49914195 GTCGGCTGGGTACTGGCGGGGGG - Intergenic
1137707892 16:50548238-50548260 GAGGGCGGGGCGCTGACGGGAGG - Intergenic
1140517804 16:75556829-75556851 CTCGTCTGTGCACTGACGAGTGG + Intergenic
1141563595 16:84886433-84886455 GTGGGCTGGCCTCTCTCGAGGGG + Intronic
1141602373 16:85134543-85134565 CTGGGCTAGGCCCTGAGGAGAGG - Intergenic
1142066821 16:88067645-88067667 GGGGGCTGGGCACTGGGGAGCGG - Intronic
1143314492 17:6022067-6022089 GTGAGATGGGCACTGAGGACAGG - Intronic
1145738952 17:27255935-27255957 GTGGGCTTGGCCCTGAAAAGGGG + Intergenic
1146062221 17:29613390-29613412 GAGGGCTGGGCACTGACGCCGGG - Exonic
1147616089 17:41828751-41828773 TTGGGCTGGGAAAGGACGAGGGG - Intronic
1148600818 17:48892947-48892969 GTGGGCTGGGCAGTGTGGAGGGG + Intronic
1149175090 17:53859749-53859771 GTGGGCTGGGGGATGACGGGAGG + Intergenic
1150247775 17:63689164-63689186 GTGGCCTGGGCCCTGTAGAGGGG + Intronic
1151783495 17:76263273-76263295 GTGGGCTGGGACCTGGCGTGTGG - Intergenic
1152285392 17:79409784-79409806 GGGGGATGGGCACTGGTGAGAGG + Intronic
1153770076 18:8408240-8408262 GTGAGCTGGGCCCTGACCAGGGG + Intergenic
1153783591 18:8515242-8515264 GTGGGCAGGCCCCTGAGGAGTGG - Intergenic
1155514867 18:26614488-26614510 GTGGGATGGGCAGAGAGGAGAGG + Intronic
1156354247 18:36328112-36328134 ATGTGCTGGGCACTGGGGAGAGG + Intronic
1156469772 18:37370010-37370032 CTAGGCTGGGCTCTGAGGAGAGG - Intronic
1157439141 18:47696906-47696928 GTGGGCAGGGCACAGAGGAGAGG - Intergenic
1157439191 18:47697112-47697134 GTGGGCAGGGCGCAGAGGAGAGG - Intergenic
1159959647 18:74545602-74545624 GTGGACTGGGGACAGAGGAGGGG - Intronic
1161293762 19:3509093-3509115 GTGGGCAAGGCAGTGACAAGCGG - Intronic
1161328193 19:3673342-3673364 GTGTGCCGGGCAGTGAGGAGGGG - Intronic
1161608819 19:5229673-5229695 GCGCGCTGGGCACTGGCGGGCGG + Exonic
1162033528 19:7927319-7927341 GTGGGAAGGGCACTGTTGAGAGG + Intronic
1163645133 19:18485072-18485094 CTGGCCTGGGCTCTGATGAGGGG - Intronic
1163664804 19:18598233-18598255 GGGGGCTGCGGACTGATGAGCGG + Intronic
1164325864 19:24190873-24190895 GTGGGCTGGGCCCAGACTATAGG + Intergenic
1164601574 19:29566671-29566693 GTGTGATGGGCACTGAGGAGGGG + Intergenic
1164601667 19:29567038-29567060 GTGTGATGGGCACAGAGGAGGGG + Intergenic
1164856594 19:31529695-31529717 GTGGGCAGGGCAATGAAGAGAGG - Intergenic
1165423913 19:35735335-35735357 GTGGGCTGGGGACTGACCACTGG - Intronic
1166048236 19:40242267-40242289 GAGGGCTGGGCTCTGACGTGGGG + Intronic
1168523175 19:57068812-57068834 GTGGGCTGGGCAGTGGTAAGAGG + Intergenic
925715658 2:6782309-6782331 GTGGGCTTGGTACTGACACGTGG - Intergenic
929925068 2:46201091-46201113 GTGGGGAGGGCACTGATCAGGGG - Intergenic
932702297 2:74000231-74000253 GGGGGCTGGGCACTGAGAAGTGG - Intronic
934475649 2:94591673-94591695 ATGGGCTGGCCACGGAGGAGTGG - Intronic
934663104 2:96153591-96153613 GTGGGCAGGGCACTGGTGGGTGG - Intergenic
934780333 2:96965919-96965941 ATGGGGTGGACACTGAGGAGTGG - Intronic
938207572 2:129437369-129437391 GTGTGCTGGGGACTGCGGAGAGG - Intergenic
940001633 2:148972301-148972323 GTGGGCTGGGAACTGGGGTGAGG + Intronic
942189612 2:173457044-173457066 GTGGGATGGCCACAGAAGAGAGG + Intergenic
944515822 2:200510431-200510453 GAGGGATGGGCACTGACCTGGGG - Intronic
947060284 2:226156827-226156849 GAGGGGTGGGCAGTCACGAGGGG + Intergenic
947812004 2:233010717-233010739 GGGGTCTGAGCACTGAGGAGGGG - Intronic
948873354 2:240815029-240815051 GTGGGCTAGGCGCAGACCAGAGG - Intronic
949027766 2:241774397-241774419 GTGGGCTGGGCGCTGGCAGGAGG - Intergenic
1169815176 20:9649011-9649033 GTCTGCTGGACACTGAGGAGTGG - Intronic
1170817557 20:19727669-19727691 GTGGGCTAGGCAATGAGGAAGGG + Intergenic
1173826634 20:46051882-46051904 GGGGGCTGGGGACAGAAGAGGGG + Intronic
1173849339 20:46208074-46208096 CTGTGCTGGGCATTGAGGAGAGG - Intronic
1175317551 20:58059610-58059632 GTGGGCTGTCCACTGACTAAGGG - Intergenic
1175826557 20:61939374-61939396 GGGGGCTTGGCAGTGACAAGAGG - Exonic
1176125912 20:63474532-63474554 GTAGCCCGGGCACTGCCGAGGGG - Intergenic
1177049268 21:16211457-16211479 TGTGGCTGGGCACTGAAGAGTGG - Intergenic
1177438500 21:21087420-21087442 GTGGACTGTGCTCTGAAGAGGGG - Intronic
1179596326 21:42445338-42445360 GCTGCCTGGGCACTGACCAGTGG - Intronic
1180705101 22:17804632-17804654 GCAGACTGGGCACTGCCGAGAGG + Intronic
1181044692 22:20209025-20209047 GTGGGCGGGGCACTGCAGAGTGG - Intergenic
1181571763 22:23771779-23771801 GCTTGTTGGGCACTGACGAGGGG + Intronic
1181625320 22:24118928-24118950 GTGGGCTGAGCACTGAGCAGGGG + Intronic
1182550577 22:31098854-31098876 GTGGGCTGGGCAGTGGGGGGCGG + Intronic
1182880309 22:33727300-33727322 TGGGGCTGGGCACTGAACAGAGG + Intronic
1183777042 22:39972979-39973001 GAGGGCTGGGCAGTGGGGAGAGG + Exonic
950008155 3:9704501-9704523 CTGAGCCGGGCACTGAGGAGAGG - Intronic
950578809 3:13849949-13849971 GTGGGCTGGGGAATGACATGGGG - Intronic
950742203 3:15061013-15061035 GTGGGGTGGGAACTGATCAGAGG - Intronic
951641586 3:24842666-24842688 GTGGGCTCTGAACTGAAGAGAGG - Intergenic
953169047 3:40490991-40491013 GAGGGCTGGGAACTGTGGAGGGG - Intergenic
953410156 3:42686342-42686364 TCGGGCTGGGCACGCACGAGAGG - Exonic
953552696 3:43916589-43916611 ATAGGCTGGGCACTGATGTGGGG + Intergenic
953932461 3:47012516-47012538 GTGGTCTGGGCACTGCCCTGTGG + Intergenic
954176104 3:48847305-48847327 GTGGGCGGGGCCCTGGGGAGTGG - Intronic
954314877 3:49795646-49795668 GTGGGCTGGGCACCGGAGACAGG + Exonic
954442805 3:50530937-50530959 GGGGGCTTGGCACGGAGGAGGGG + Intergenic
955348705 3:58179006-58179028 GTGGGATGGGCACTTGAGAGAGG - Intergenic
968546466 4:1201283-1201305 GTGGGCTGGGGACTCACGGCCGG - Intronic
968718288 4:2178230-2178252 GTGTGCTGGGCACTGAGCTGGGG - Intronic
969350181 4:6593784-6593806 GTGTGCTGGGCACTGCCCCGTGG + Intronic
969725221 4:8914622-8914644 GTGGCCGGGGCACGGACGAGGGG - Intergenic
985331206 4:188837449-188837471 GTGTGCTAGGCACTGAGGATAGG - Intergenic
985677064 5:1237639-1237661 AGGGGCTGGGCCCTGAAGAGGGG - Intronic
986004861 5:3659142-3659164 GTGGACTGGGCTCTTAGGAGGGG + Intergenic
986411845 5:7488806-7488828 GTGGGCTGGGCACTGACGAGGGG - Intronic
992135189 5:73737377-73737399 GTGGGCTGGGGAGTGATGACGGG - Intronic
992240839 5:74767500-74767522 GTGGGGTGGGCTCTGAGGAGTGG + Intronic
1001595630 5:172896947-172896969 GGGTGGTGGGCACTGACGAAGGG - Intronic
1001907810 5:175487535-175487557 GTGGGCTGGGGAGTGACTGGTGG - Intronic
1002164505 5:177336136-177336158 GTGGGCTGGGGACACAGGAGGGG + Intronic
1003317867 6:5027868-5027890 GAGGGCTGGGCACAGGAGAGAGG + Intergenic
1003967214 6:11264205-11264227 AGGGGCTGGGCAGTGGCGAGAGG + Intronic
1006054258 6:31369441-31369463 GTGGGCTGGGCCCTCAGCAGTGG - Intergenic
1006131273 6:31870795-31870817 GTGGGCAGGACACTCACGGGCGG + Exonic
1006379576 6:33689675-33689697 GCGGGCTGTGCACTGCCCAGAGG + Intronic
1006387289 6:33738376-33738398 GTGAGCTGGGGAAAGACGAGGGG - Intronic
1006426506 6:33966648-33966670 GGGGGCTGGGCTGTGAAGAGTGG - Intergenic
1006512443 6:34528964-34528986 GTGGGCTGGGCACTGCCCTCTGG + Intronic
1007500125 6:42290410-42290432 GAGGGCTGGCCACAGGCGAGGGG - Intronic
1011732352 6:90278336-90278358 CTTGGCTGGGCACTGACGAGTGG - Intronic
1016882463 6:148924279-148924301 GTGAGCAGGGCAGGGACGAGGGG - Intronic
1019711363 7:2519612-2519634 GGGGGCTGGGAACTGCCCAGAGG - Intronic
1020213344 7:6171185-6171207 GTGGGCTCTGCACTGACCTGTGG + Exonic
1021463644 7:20916791-20916813 GTGGGCAGGGAACTAAGGAGGGG + Intergenic
1023447273 7:40244929-40244951 GTGGGATGGGCACAGAGGAAAGG - Intronic
1023684822 7:42723432-42723454 GAGGGTTAGGCACTGACGAATGG - Intergenic
1029839219 7:103344542-103344564 GTTGGGTGGGCACTTACCAGAGG + Exonic
1031875970 7:127141228-127141250 GTGGGATGGGCACTAGGGAGGGG - Intronic
1032265749 7:130368762-130368784 ATGGGCTCAGCACTGACAAGGGG + Intergenic
1035236711 7:157501817-157501839 GTGGGCGGGGCATTGAAGACAGG + Intergenic
1035299405 7:157887493-157887515 GGGGAGTGGGTACTGACGAGTGG - Intronic
1035560956 8:603114-603136 GGGGCCTGGGCACTGAGGTGGGG - Intergenic
1035730909 8:1853072-1853094 TTGGGCCGGGCACTGGCGGGTGG + Intronic
1036341015 8:7915664-7915686 GAGGGCTGGGCAGTGACAAAGGG - Intergenic
1039911801 8:41832459-41832481 GTGGGCAGGGCATGGAGGAGGGG - Intronic
1040741361 8:50579894-50579916 GTGGGGTAGGCACTGCCCAGTGG + Intronic
1044591317 8:93916853-93916875 ATTGGCTGCGCAGTGACGAGTGG - Intronic
1048015181 8:130490899-130490921 GGGGGCTGGGCACTGAGGGTGGG + Intergenic
1049042478 8:140123195-140123217 GTGGGAAGGGCTCTGAAGAGGGG - Intronic
1049285712 8:141774128-141774150 ATGGGCTGTGCACTGAGGAATGG - Intergenic
1051328306 9:15997328-15997350 GTTGGCTGGGGACTGCCCAGAGG + Intronic
1051824985 9:21210392-21210414 GGGCGCTGGGCAGTGACAAGTGG + Intronic
1051826976 9:21232455-21232477 GGGTGCTGGGCAGTGACAAGTGG + Intronic
1052854411 9:33398244-33398266 ATGGGCTGGCCACGGAGGAGTGG + Intronic
1053682416 9:40494405-40494427 ATGGGCTGGCCACGGAGGAGTGG + Intergenic
1053932399 9:43122731-43122753 ATGGGCTGGCCACGGAGGAGTGG + Intergenic
1054281298 9:63130524-63130546 ATGGGCTGGCCACGGAGGAGTGG - Intergenic
1054295515 9:63329905-63329927 ATGGGCTGGCCACGGAGGAGTGG + Intergenic
1054393535 9:64634409-64634431 ATGGGCTGGCCACGGAGGAGTGG + Intergenic
1054428184 9:65139623-65139645 ATGGGCTGGCCACGGAGGAGTGG + Intergenic
1054502196 9:65881921-65881943 ATGGGCTGGCCACGGAGGAGTGG - Intronic
1057268472 9:93634012-93634034 GTGGGCTGGGCTCCAAGGAGAGG - Intronic
1057695522 9:97320377-97320399 GCAGGCTGGGCACTGAGGAGGGG - Intronic
1058431718 9:104926672-104926694 CTGGGCTGGGCTCTGCCGTGAGG - Intronic
1061361190 9:130143343-130143365 GTGGGCGGGCCAGTGCCGAGGGG - Intergenic
1061993527 9:134172879-134172901 GTGGGCTGGGGACAGGCAAGAGG + Intergenic
1062452791 9:136622566-136622588 CTGTGCTGGGCCCTGACCAGAGG - Intergenic
1062530674 9:136998201-136998223 GTGGGCTGTGGACTGTGGAGCGG + Intergenic
1185619092 X:1442518-1442540 GTGGGCCGCGGACTGACCAGGGG + Intronic
1189102860 X:38209274-38209296 ATGGGCTGGCCGCTGAGGAGAGG - Intronic
1192141019 X:68647380-68647402 GTGGTCTGGGCTCTACCGAGAGG + Intergenic
1192200859 X:69065894-69065916 GAGGGCAGGGCATTGACGGGTGG + Intergenic
1197745932 X:129932277-129932299 GTGGGAGGGGCATAGACGAGCGG - Intergenic
1199991659 X:152990746-152990768 CTGTGCTGCGCACTGACAAGGGG + Exonic
1200182547 X:154159512-154159534 GTGAGCTGATCAGTGACGAGGGG + Intergenic
1200188201 X:154196626-154196648 GTGAGCTGATCAGTGACGAGGGG + Intergenic
1200193851 X:154233766-154233788 GTGAGCTGATCAGTGACGAGGGG + Intergenic
1200199606 X:154271570-154271592 GTGAGCTGATCAGTGACGAGGGG + Exonic
1200240520 X:154490702-154490724 GGGGGCGGGGCCCTGACGCGCGG - Intergenic
1202259954 Y:22960048-22960070 GTGGGCAGGGCACTGGCAGGAGG - Intergenic
1202412940 Y:24593792-24593814 GTGGGCAGGGCACTGGCAGGAGG - Intergenic
1202457841 Y:25076278-25076300 GTGGGCAGGGCACTGGCAGGAGG + Intergenic