ID: 986415529

View in Genome Browser
Species Human (GRCh38)
Location 5:7524543-7524565
Sequence CTGTAGAAGATCAAAGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986415529_986415532 -2 Left 986415529 5:7524543-7524565 CCAGTCTCTTTGATCTTCTACAG 0: 1
1: 0
2: 2
3: 14
4: 210
Right 986415532 5:7524564-7524586 AGGATGGAACAATTCTTTAGTGG 0: 1
1: 0
2: 0
3: 25
4: 218
986415529_986415533 6 Left 986415529 5:7524543-7524565 CCAGTCTCTTTGATCTTCTACAG 0: 1
1: 0
2: 2
3: 14
4: 210
Right 986415533 5:7524572-7524594 ACAATTCTTTAGTGGTTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986415529 Original CRISPR CTGTAGAAGATCAAAGAGAC TGG (reversed) Intronic
900001767 1:18385-18407 ATGGAGAAGATCACAGAGGCTGG + Intergenic
900021487 1:188908-188930 ATGGAGAAGATCACAGAGGCTGG + Intergenic
901438893 1:9265544-9265566 CTGAAGAACAGCAAAGACACAGG - Exonic
902126518 1:14217116-14217138 TGGTAGAAGAGCAAAGAGAGAGG - Intergenic
902931168 1:19732525-19732547 CTCTAGATGATCAATGAGGCAGG + Intronic
903283391 1:22262904-22262926 CTCTAGAAGATTAAAGAGTCTGG - Intergenic
903356561 1:22751721-22751743 ATGTACAAGATCAAAGACAGTGG + Intronic
903527432 1:24002513-24002535 ATGAAGAAGATAAAAGAGGCCGG + Intergenic
904300284 1:29549640-29549662 CTGATGAAGATCAAAGGGACCGG - Intergenic
904457950 1:30658475-30658497 CTGATGAAGATCAAAAGGACTGG + Intergenic
905997416 1:42393214-42393236 CTGTAGAAGCTCACTCAGACAGG - Intronic
908649076 1:66312379-66312401 CTCTAGAAGCTGGAAGAGACAGG - Intronic
909169389 1:72275437-72275459 CTTTAGAAAAGCAAAAAGACAGG + Intronic
909741802 1:79038096-79038118 CTGGAGAAGGAGAAAGAGACAGG - Intergenic
911373333 1:97020767-97020789 CTATAGAACATCAAAGATAAGGG + Intergenic
912567205 1:110596547-110596569 GTAGAGAAGACCAAAGAGACAGG - Intronic
914202073 1:145494324-145494346 CTGTACAACATCAAAGTGAGTGG + Intergenic
914236001 1:145812234-145812256 CTGTACAACATCAAAGTGAGTGG + Intronic
914481196 1:148067466-148067488 CTGTACAACATCAAAGTGAGTGG + Intergenic
915298751 1:154940262-154940284 CTGTTCAAAATCAAAGGGACAGG - Intergenic
916624480 1:166540234-166540256 CTGTAGAAGGTGCAAGAGAAAGG + Intergenic
918343696 1:183588267-183588289 CTGTGGAAGATAAAAAAGATAGG + Intronic
920498901 1:206474101-206474123 CTGCAGAAGATCAGAGTGTCAGG + Intronic
921510630 1:216023353-216023375 TTGTAGGTGATAAAAGAGACAGG + Intronic
922577998 1:226675926-226675948 CTGTAGAAGATCCCATAGTCTGG + Intronic
923294234 1:232577802-232577824 TTGTAGAGGAACAAAGAAACTGG + Intergenic
924224524 1:241909915-241909937 CTGTAGATAATCAAAGACAAAGG - Intergenic
1062984012 10:1749881-1749903 CTGTAGAAGATCAAAGGAAAGGG + Intergenic
1065462110 10:25979629-25979651 CTATAGAATTTCACAGAGACTGG - Intronic
1069403179 10:68071056-68071078 CTGTGGAAGAGAAAAGTGACAGG - Intronic
1069491106 10:68861299-68861321 CTTCAGAAGAACAAAGGGACAGG + Intronic
1070990621 10:80729100-80729122 CTGGACAAGATTGAAGAGACTGG + Intergenic
1072653112 10:97310882-97310904 CTGCAAAAGAACAAAGAGATGGG - Intergenic
1072956833 10:99894267-99894289 CTCTAAAAGATCAGAGGGACAGG + Intronic
1073533899 10:104257159-104257181 CTGTAGAGGAACTAAGAGAAAGG - Intronic
1073603438 10:104869339-104869361 ATGTTGAAGATCAAACAGTCAGG + Intronic
1074161296 10:110838559-110838581 CTGTACATTATCAGAGAGACTGG + Exonic
1078258226 11:9679511-9679533 CTGAAGACGATCACTGAGACTGG - Intronic
1079544305 11:21614195-21614217 CTGTAGGAAATAAAACAGACAGG - Intergenic
1080285196 11:30603034-30603056 TGGCAGAAGATAAAAGAGACTGG - Intergenic
1081245880 11:40765299-40765321 CTGGAGAAGAAGAAAGAGAGAGG - Intronic
1081752909 11:45524779-45524801 TGGGAGAAGATCAAAGACACTGG - Intergenic
1082935379 11:58651325-58651347 CTCTCAAAGATCAAAGAGAGAGG - Intronic
1083264767 11:61541658-61541680 CTATAGAAGGTCAGAGAGATGGG + Intronic
1086073494 11:82824831-82824853 ATGTAGAAAATCAAAGTGAATGG + Exonic
1086620245 11:88878915-88878937 TTGCAGAAGATAAAAGAGACTGG + Intronic
1086730451 11:90241885-90241907 CTGTGGAAATTCAAAAAGACTGG - Intergenic
1086784867 11:90955617-90955639 CCGTAGAAAATCAAAGACAATGG + Intergenic
1088149967 11:106732917-106732939 TTGTAGCAGATGAATGAGACAGG - Intronic
1088938462 11:114428459-114428481 CTGTAAAAGTTCAGTGAGACAGG - Intronic
1090054179 11:123407696-123407718 CTGAAGAAAATCAAATTGACAGG + Intergenic
1091341822 11:134821880-134821902 CTGAAGAAGAGTGAAGAGACTGG - Intergenic
1091374845 12:18490-18512 ATGGAGAAGATCACAGAGGCTGG + Intergenic
1093485918 12:19652403-19652425 CTGTAGATGAGAAAAAAGACAGG - Intronic
1094054891 12:26258717-26258739 CAGTATTAGATCAATGAGACAGG + Intronic
1096878789 12:54650556-54650578 CTGGAGAATATCAAAGGGGCAGG - Intergenic
1097345472 12:58487449-58487471 CTGTTGTAAATCAAAGAGAGGGG + Intergenic
1097816455 12:64079881-64079903 GTCTAGAAGATCAAAGTGGCTGG + Intronic
1098017834 12:66125182-66125204 ATGTAGAAGATAAATGAGAAGGG + Intronic
1098188690 12:67925212-67925234 ATGTAGAAGATAAAAGGGAATGG + Intergenic
1099034114 12:77564264-77564286 CTGAAGAAGTTTAAAGAAACAGG - Intergenic
1101859413 12:108470681-108470703 CTGGAGGACATCCAAGAGACAGG + Intergenic
1101907330 12:108837299-108837321 CTGCAGGAGAGCCAAGAGACAGG + Intronic
1103037816 12:117670753-117670775 CTGTAATAGATGAAGGAGACAGG + Intronic
1103674363 12:122644088-122644110 CTCTAGAAGAGCATACAGACGGG + Intergenic
1103824735 12:123728539-123728561 ATGAAGGAGATCAGAGAGACAGG - Intronic
1103865109 12:124045358-124045380 CTGTAAAAGATATAAGAGAGAGG - Intronic
1108293554 13:48988226-48988248 CAGTATTAGATCAACGAGACAGG + Intronic
1108507184 13:51123044-51123066 CTGGATAAGATCAAAGAAAACGG - Intergenic
1111281647 13:86032921-86032943 CCTTACAAGATAAAAGAGACTGG - Intergenic
1112321140 13:98408675-98408697 CTTTATAAGATAAAAGTGACAGG - Intronic
1112678468 13:101732951-101732973 CTGTAAAAGATGAAAGAGATTGG - Intronic
1112737197 13:102434033-102434055 CTGCAGATCATCAAAGAGAAAGG - Intergenic
1116262729 14:42652469-42652491 CTGTAAAAGATAAAAGAAATGGG + Intergenic
1117001595 14:51376279-51376301 CTGCAGAAGATCACAGGGCCTGG - Intergenic
1117024901 14:51609214-51609236 CTCTGTAAGATCCAAGAGACAGG + Intronic
1118764744 14:68902270-68902292 CAGTAGAAGATGAGAGAGAGAGG + Intronic
1119664415 14:76474240-76474262 CTGTTGAAGGTCATAGAGTCTGG - Intronic
1121091676 14:91187301-91187323 CTGGAGAATATGAAAGACACGGG - Intronic
1121397294 14:93637325-93637347 CTGTAAAAGCTGAAGGAGACTGG + Intronic
1125061715 15:35433923-35433945 CTGTGGAAGAGAAAAGAGAAGGG + Intronic
1127166572 15:56249827-56249849 CTGTAGAAAATCAAAGATTGGGG + Intronic
1129009728 15:72404542-72404564 CTGTAGAAAATCTGAGTGACTGG - Intronic
1129359470 15:75015545-75015567 CTGTAGAAGGTCAGAGGGATGGG + Intronic
1130146403 15:81277406-81277428 CTGCAGAATATCAAAGACAAAGG + Intronic
1131243790 15:90772359-90772381 CTGGAAGAGAGCAAAGAGACAGG + Intronic
1131768671 15:95710537-95710559 CTCTACAAGATTAAAGAGATGGG - Intergenic
1132451744 15:101972555-101972577 ATGGAGAAGATCACAGAGGCTGG - Intergenic
1132455148 16:18074-18096 ATGGAGAAGATCACAGAGGCTGG + Intronic
1133293209 16:4736368-4736390 CTGTAGGAGACCAAACAGGCTGG - Intronic
1133442645 16:5833525-5833547 CTGTAGAAGGTCAAAAGGAAAGG + Intergenic
1138084666 16:54122565-54122587 CTGTTGAAGATCAAATAATCTGG - Intergenic
1138284340 16:55797327-55797349 CAGAAGAAGAACAAAGACACAGG + Intergenic
1138284662 16:55799660-55799682 CAGAAGAAGAACAAAGACACAGG - Intergenic
1138300613 16:55925941-55925963 CTGTGGGAGATAAAAAAGACAGG + Intronic
1141634138 16:85304722-85304744 CTGCAGAAGATGGCAGAGACAGG + Intergenic
1147310989 17:39596117-39596139 CTCTATAAGAACAAAGAGTCAGG + Intergenic
1149168967 17:53786815-53786837 CAGTCGAAGATCAAAGTGTCAGG - Intergenic
1151128790 17:71874163-71874185 ATGTTGAAGATAAAGGAGACAGG - Intergenic
1155633073 18:27918465-27918487 ATGTAGAAGAACAAAGGGAATGG + Intergenic
1163587307 19:18170959-18170981 CTTGAGAACATCAAAGACACGGG - Intronic
1167448405 19:49552963-49552985 CCGTAGCAGAAGAAAGAGACGGG - Intergenic
927557515 2:24046293-24046315 CTGTATAAGATCAGAGGGCCAGG + Intronic
927874047 2:26642603-26642625 CTGTAGGAGATCACAGAAAGAGG - Intergenic
928734119 2:34265977-34265999 CTGTAGAAGATCAAAGAACTTGG + Intergenic
932519512 2:72395311-72395333 ATGTGGAAGTTAAAAGAGACTGG - Intronic
936258081 2:110934566-110934588 CTGTAGAAAATAAAAGGGAAAGG + Intronic
936567955 2:113595022-113595044 ATGGAGAAGATCACAGAGGCTGG - Intergenic
938449583 2:131405150-131405172 CTGCAGAAGACCACAGAGAAAGG - Intergenic
939846618 2:147254673-147254695 CTGTAGAAGAGTAAAAAGAAGGG + Intergenic
941843521 2:170112016-170112038 CTGTAGGAGATCAATCAGAGTGG + Intergenic
943296265 2:186143862-186143884 CAGGAGAAGATGAAAGTGACTGG - Intergenic
944123854 2:196271231-196271253 CTGTAGAATTTCAAAGATATTGG + Exonic
946715109 2:222545962-222545984 CTGTAGAAGAGCAAAGTAGCTGG + Intronic
946867409 2:224054768-224054790 CTGAAGAAGATCTATGGGACAGG + Intergenic
1170193694 20:13669201-13669223 CTTTAGAAAATCAAATATACAGG - Intergenic
1170809847 20:19665563-19665585 CTGTACAACATCAGAGTGACAGG - Intronic
1176738272 21:10573112-10573134 CTGTAAAGGATCATACAGACTGG + Intronic
1177415926 21:20793483-20793505 ATAAAGAAGATCAGAGAGACAGG - Intergenic
1177807426 21:25887984-25888006 CCGCAGAAGATCACAGAGATAGG - Intronic
1178158375 21:29881691-29881713 CAGTAGAAGAAGAAAGGGACAGG - Intronic
1178238685 21:30873785-30873807 CTGCAGAAGGTCAAAGAGCAGGG - Intergenic
1180906013 22:19412237-19412259 ATGTAGAGCATCAAAGAGCCCGG + Intronic
1183971219 22:41478974-41478996 CTGCAGAAGGTCAAGGAGCCCGG - Intronic
951272762 3:20647328-20647350 TTGTAGAAAAGCAAAGAGAGGGG - Intergenic
951444686 3:22764930-22764952 CTGTAAAAGGACAAAGAGAAAGG - Intergenic
951866191 3:27310973-27310995 CAGTCAAAGATCAAAGAGAATGG - Exonic
952908402 3:38159974-38159996 ATGGAGAAAATCAAGGAGACAGG + Intergenic
953258089 3:41309305-41309327 CTGTAGAACAACAAAGATAAAGG + Intronic
953727060 3:45408664-45408686 CTGCAGAAGCTCAAACAGGCTGG - Intronic
953863383 3:46564158-46564180 CTGTAGAAGCCAAAAGAGAAAGG + Intronic
954903985 3:54044055-54044077 CTGTAGGAGATCAGAGGGAGAGG + Intergenic
955134527 3:56203311-56203333 TTGTAGAAGCTGAAGGAGACCGG + Intronic
957304246 3:78436405-78436427 CTGCTGAAGATCATAGAGACTGG + Intergenic
957636626 3:82793815-82793837 CTGCAGAAGAGCAAAAATACAGG + Intergenic
957700475 3:83704044-83704066 TTTAAGAAGATCAAAGAGAATGG + Intergenic
963018261 3:140846443-140846465 CTGAAGATGATCAAAGAGATAGG + Intergenic
963057953 3:141202615-141202637 ATGTAGAGGAGCAAAAAGACGGG - Intergenic
963708230 3:148715359-148715381 CTGTAGAAAATCAAATTAACAGG - Intronic
965055835 3:163714917-163714939 CTGTAGAAGAGTAATGAAACAGG + Intergenic
965450810 3:168835464-168835486 ATGTAGAAGATAAAGGTGACTGG + Intergenic
965739152 3:171855156-171855178 CTGAAGAATGTCAAAGAGATAGG - Intronic
966939608 3:184737267-184737289 CTGAGGAGGAGCAAAGAGACAGG - Intergenic
968149662 3:196327242-196327264 CTGTAGAAGCTCTAAGAGACAGG - Intronic
969461523 4:7331597-7331619 CTGTAGAGGATCTTAAAGACAGG - Intronic
969647713 4:8442314-8442336 CTGTGAAAGAGCATAGAGACTGG + Intronic
972090447 4:35275102-35275124 CAGTATAAAAGCAAAGAGACAGG + Intergenic
972541632 4:40044019-40044041 CTGAAGATGATCAAAGAGGCGGG - Intergenic
976462719 4:85331010-85331032 CTGTAGAGGATCAATGGGAATGG + Intergenic
977344607 4:95801769-95801791 CTGAGGAAGATAAAAGAGGCAGG - Intergenic
978280668 4:107008650-107008672 ATGTAGAAGATCAAAGAGAGAGG + Intronic
978394085 4:108259467-108259489 CTGTAGAAGATTTAAGAGATTGG + Intergenic
978971234 4:114808373-114808395 CTCTGGAAGAACAAAGAGTCAGG + Intergenic
982861457 4:160455568-160455590 CTGAAGAAGATCAAAGTTGCAGG - Intergenic
984343751 4:178492477-178492499 CTGTCAAAGATCAAAGACAAAGG + Intergenic
984857086 4:184204626-184204648 AAGTAGGAGATGAAAGAGACTGG - Intronic
985261513 4:188118904-188118926 CTGTAGAGTCTCAAAGAGAGAGG + Intergenic
985295671 4:188434966-188434988 CTGTAGAAGAGACAAGAGAAAGG + Intergenic
985437910 4:189950406-189950428 ATGTAGAACATCAAAGGCACAGG - Intronic
986415529 5:7524543-7524565 CTGTAGAAGATCAAAGAGACTGG - Intronic
989501141 5:42169739-42169761 CTGTAGAACATAAGAGAGAATGG - Intergenic
989729246 5:44628441-44628463 ATGTAGTGGATAAAAGAGACAGG - Intergenic
989801508 5:45547021-45547043 ATGTAGAGAATCATAGAGACCGG - Intronic
990501503 5:56400899-56400921 CCATAGAAGATCAAAGAAAGAGG + Intergenic
993966091 5:94362593-94362615 CAGTAGAAGATCACAGAGGAGGG - Intronic
994780835 5:104088017-104088039 CTCTAGAAGCTGAAAGGGACAGG - Intergenic
996512751 5:124335567-124335589 CTGAAGACGAGAAAAGAGACTGG - Intergenic
996864568 5:128105445-128105467 CTGTAGGAGTTCAGTGAGACAGG + Intronic
997280404 5:132640094-132640116 CTGTAGAAAATCCAAGTAACTGG - Intronic
998014794 5:138723532-138723554 ATGGAGAAGATGAAAGAGAGGGG + Intronic
1005356988 6:24994571-24994593 CTGTAGAAGAGCAAAGAAGAAGG + Intronic
1006096373 6:31659186-31659208 CTGCAGGAGACCAAAGAGGCAGG + Exonic
1006204728 6:32330539-32330561 CTGTAGAAGATCAAGGAACCTGG + Intronic
1006339855 6:33440866-33440888 CTGCATAAGCCCAAAGAGACTGG - Exonic
1006517642 6:34553665-34553687 CTGGAGAAGAGGAAAGAGAGAGG + Intronic
1007541354 6:42648112-42648134 CTTTAGGAGAACAAGGAGACTGG + Exonic
1007860955 6:44907970-44907992 CTGTGGAGGACCAAAGAGCCAGG + Intronic
1008048748 6:46878264-46878286 CTGCAGCAGTTCAAAGATACAGG + Exonic
1008916616 6:56794694-56794716 CTGGAGAGAGTCAAAGAGACAGG + Intronic
1014078584 6:117264829-117264851 GTGGAGAACATCAAAGAGAAAGG + Intergenic
1014759469 6:125340631-125340653 CTCTAGAGGATCAAAGTAACTGG - Intergenic
1015895571 6:138013326-138013348 CTTTGGAAGACCAAAGAGGCAGG - Intergenic
1016664540 6:146621258-146621280 CTGTGGCACATAAAAGAGACTGG + Intronic
1019552355 7:1609350-1609372 ATCTAGAAGGTCAAATAGACAGG + Intergenic
1021825319 7:24545023-24545045 CTGTAGAACATCTATGAGATTGG - Intergenic
1022783876 7:33615777-33615799 CTGCAGAAAATCAAAGATAAAGG + Intergenic
1024794068 7:53002447-53002469 CTGTAGGAGCTCAAAGAGAAAGG + Intergenic
1024880364 7:54078851-54078873 CTGTGGAAGAGCAAAGAGGGAGG + Intergenic
1026323174 7:69285084-69285106 AGGTAGACGGTCAAAGAGACAGG + Intergenic
1027418621 7:77998344-77998366 ATGAGGAAGATCAAAGAGAGAGG + Intergenic
1027582009 7:80009297-80009319 CTGAAGAAGAACAAAGACAGAGG + Intergenic
1027720622 7:81737092-81737114 ATGTAGAAGATAAAATTGACAGG + Intronic
1032510792 7:132470799-132470821 CTTTAGAAGCTGAAAAAGACAGG + Intronic
1033470155 7:141639910-141639932 TTGTAGAAGAATAAAGACACAGG + Intronic
1035085135 7:156251891-156251913 CTGCAGAAGCTCACAGACACAGG + Intergenic
1035283090 7:157789403-157789425 TTGTACAAGGTCAGAGAGACTGG + Intronic
1035958308 8:4107816-4107838 CTTTATAAGAACGAAGAGACAGG + Intronic
1035969217 8:4228516-4228538 TTGTAGAAGAGCCAAGATACAGG - Intronic
1036430514 8:8685475-8685497 CTGTAGCAGAACAGAGAGAAAGG - Intergenic
1039118766 8:34122243-34122265 CTGAAGAAGACAAAAGAGTCTGG + Intergenic
1042188228 8:66158028-66158050 CTGTAGAAGCCCAAGGAAACTGG - Intronic
1043829223 8:84968051-84968073 CTGAAGGAGATAAAAGAGATAGG + Intergenic
1044126867 8:88469960-88469982 CTTTAGAAAATCAAAATGACTGG - Intergenic
1045319991 8:101075146-101075168 CTGTAGGAGAACAAAGGGAAAGG - Intergenic
1045963424 8:107996135-107996157 CTGGAGAAGAGCAATGAAACTGG + Intronic
1047459689 8:125050803-125050825 CTGTGCAAGATCACAGGGACAGG - Intronic
1047862715 8:128986288-128986310 ATTTAGAAGATCAAAGCAACAGG + Intergenic
1049884575 9:18498-18520 ATGGAGAAGATCACAGAGGCTGG + Intergenic
1051579652 9:18657223-18657245 CTGCAGAAAATAAAAGATACTGG - Intronic
1052215670 9:25963455-25963477 CTGTAGAAGATCTAATAAAAAGG + Intergenic
1057563829 9:96150691-96150713 CTGAAGCAGATCAATGGGACGGG - Intergenic
1058500403 9:105609568-105609590 CTGAAGAAGACTAAAGAGACAGG - Intronic
1058809516 9:108626043-108626065 CTGTAGAAGCTCATAAAGCCTGG - Intergenic
1060543583 9:124447900-124447922 CTGTAGAAGAAGAAACAGAGTGG + Intergenic
1187722122 X:22162081-22162103 CTAGAAAAGATCAAAGATACAGG - Intronic
1188258224 X:27988294-27988316 CTGTAGGAGATCAATCAGAGTGG - Intergenic
1188358033 X:29216493-29216515 CTGTAGAAAATACAAGAAACAGG - Intronic
1188760257 X:34019066-34019088 CTGTAGAGGAACAGAGAGAAAGG - Intergenic
1189332455 X:40152294-40152316 CGGTAGTATATCAAAGGGACGGG - Intronic
1191974338 X:66853758-66853780 CTGAAGAAAATAAAAGAGAGAGG - Intergenic
1192748252 X:73961774-73961796 CTGCAGAAAATCAAAGATACAGG - Intergenic
1192750050 X:73980196-73980218 CTGTTGAAAATCAAAGACAAAGG - Intergenic
1195215972 X:102702830-102702852 CTGCAGAAAATCAAAGACAATGG + Intergenic
1198391806 X:136182798-136182820 ATGTATAAGAACAAAGAGGCTGG + Intronic
1199533180 X:148872309-148872331 CTGTAGAGACTGAAAGAGACTGG - Intronic
1200215368 X:154365900-154365922 CAGTAGAAGCTCAAAGAGTAGGG + Intronic
1200401231 X:156021653-156021675 ATGGAGAAGATCACAGAGGCTGG - Intergenic