ID: 986418157

View in Genome Browser
Species Human (GRCh38)
Location 5:7549282-7549304
Sequence TGCTGCCTTCGCCAGGGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 144}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986418157_986418167 18 Left 986418157 5:7549282-7549304 CCAGATCCCTGGCGAAGGCAGCA 0: 1
1: 0
2: 0
3: 12
4: 144
Right 986418167 5:7549323-7549345 CTGGGCTCATGGCAAATGGAAGG 0: 1
1: 0
2: 1
3: 17
4: 184
986418157_986418161 -1 Left 986418157 5:7549282-7549304 CCAGATCCCTGGCGAAGGCAGCA 0: 1
1: 0
2: 0
3: 12
4: 144
Right 986418161 5:7549304-7549326 ACTCCCATCTGGAGCATTGCTGG 0: 1
1: 0
2: 1
3: 12
4: 118
986418157_986418168 19 Left 986418157 5:7549282-7549304 CCAGATCCCTGGCGAAGGCAGCA 0: 1
1: 0
2: 0
3: 12
4: 144
Right 986418168 5:7549324-7549346 TGGGCTCATGGCAAATGGAAGGG 0: 1
1: 0
2: 1
3: 20
4: 211
986418157_986418169 25 Left 986418157 5:7549282-7549304 CCAGATCCCTGGCGAAGGCAGCA 0: 1
1: 0
2: 0
3: 12
4: 144
Right 986418169 5:7549330-7549352 CATGGCAAATGGAAGGGAGATGG No data
986418157_986418166 14 Left 986418157 5:7549282-7549304 CCAGATCCCTGGCGAAGGCAGCA 0: 1
1: 0
2: 0
3: 12
4: 144
Right 986418166 5:7549319-7549341 ATTGCTGGGCTCATGGCAAATGG 0: 1
1: 0
2: 2
3: 19
4: 203
986418157_986418165 7 Left 986418157 5:7549282-7549304 CCAGATCCCTGGCGAAGGCAGCA 0: 1
1: 0
2: 0
3: 12
4: 144
Right 986418165 5:7549312-7549334 CTGGAGCATTGCTGGGCTCATGG No data
986418157_986418162 0 Left 986418157 5:7549282-7549304 CCAGATCCCTGGCGAAGGCAGCA 0: 1
1: 0
2: 0
3: 12
4: 144
Right 986418162 5:7549305-7549327 CTCCCATCTGGAGCATTGCTGGG 0: 1
1: 0
2: 1
3: 15
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986418157 Original CRISPR TGCTGCCTTCGCCAGGGATC TGG (reversed) Intronic
900392294 1:2438936-2438958 GGCTGCCCTGCCCAGGGATCTGG + Intronic
900569178 1:3349970-3349992 TGCTGTCTCCTCCAGGGCTCAGG - Intronic
901054641 1:6443516-6443538 TGCTGCCTACCGCAGGAATCAGG - Intronic
903951070 1:26996238-26996260 TGCTTCCTTCCACAGGAATCTGG + Intronic
906410390 1:45574105-45574127 TGTTGCATTCGCCAGGACTCAGG - Intergenic
906716005 1:47969811-47969833 TGCTGGCTTCACCTGGGACCAGG - Intronic
907477659 1:54716106-54716128 GGCTGGCAGCGCCAGGGATCTGG - Intronic
916787040 1:168093885-168093907 TGCTGCCTCCTCCTGGGATCAGG + Intronic
918128575 1:181605393-181605415 TGCTGCCTTGGGCATGGCTCAGG - Intronic
920333307 1:205227909-205227931 GGCTGCCTCCGCCCGGGAGCGGG - Intergenic
920891691 1:209993224-209993246 GGCTGGCTTCGCCATGGAACAGG + Intronic
921552984 1:216561618-216561640 TGCTGCCTTACCCTGGGTTCAGG - Intronic
1063203425 10:3807661-3807683 TGTTGCCTTCCACAGAGATCAGG + Intergenic
1065503217 10:26402021-26402043 TGCTGCTTTCTCCACGGCTCAGG + Intergenic
1067452149 10:46388378-46388400 TGCTGTCTTGCCCAGGGAGCAGG + Exonic
1067585088 10:47471377-47471399 TGCTGTCTTGCCCAGGGAGCAGG - Exonic
1071502739 10:86215119-86215141 TGCTGCCTGAGCCAGGCCTCAGG - Intronic
1071589295 10:86856992-86857014 TGCTCTCTTCTCCTGGGATCAGG + Intronic
1071986045 10:91051410-91051432 TGCTGCCTTGGCTAGGTATCAGG + Intergenic
1072681686 10:97512194-97512216 TGCTGCCTGGGCCAGGGGCCAGG - Intronic
1073515899 10:104075276-104075298 TGCTACCCTCGCCAGAGAGCTGG + Intronic
1074410681 10:113225828-113225850 GGCTGCCCTTGCCAGGGTTCAGG - Intergenic
1075871102 10:125773338-125773360 TGCTGGCGTCCCCAGGAATCCGG - Intronic
1076335534 10:129704035-129704057 GGCCGCCTTCCCCAGGGATCAGG + Intronic
1077323921 11:1955316-1955338 TGCGCTCTGCGCCAGGGATCAGG + Intronic
1077420830 11:2449115-2449137 GGCTGCCTTGGCCAGGGTCCTGG + Intronic
1083686942 11:64382247-64382269 TGCTTCCTTCTCCAGAGATAAGG + Intergenic
1084598273 11:70130175-70130197 TGCTGCCTTGGACAAGGCTCTGG - Intronic
1088668885 11:112121965-112121987 TGCTGCCTTCGCCAGTGCAGGGG - Intronic
1089408276 11:118216983-118217005 TGTTGCCTTCCCCAGGGAGTTGG + Intronic
1202806907 11_KI270721v1_random:10511-10533 TGCGCTCTGCGCCAGGGATCAGG + Intergenic
1095510813 12:42949805-42949827 TGCTTCCTTCTCCAGGGAGCTGG + Intergenic
1095987037 12:48005458-48005480 TGCGGCCCTGGCCAGGGATCGGG + Intergenic
1095999812 12:48119614-48119636 AGCTGCATTCCCCAGGAATCTGG + Intronic
1097267677 12:57755363-57755385 TGCTGCCACCGCCGGGGCTCCGG - Exonic
1102555999 12:113726902-113726924 TCCTGGCTTCTCCAGAGATCTGG + Intergenic
1102746565 12:115253892-115253914 TGCACCCTTGGCCAGGGATATGG + Intergenic
1103850549 12:123930198-123930220 TGCTGGCTTCCCAAGGGATAGGG - Exonic
1104331752 12:127853433-127853455 TGCTGCCATAGCCAGGGTCCTGG + Intergenic
1106132834 13:26953818-26953840 TGCTGCCTTGGCCAAGGACAGGG + Intergenic
1107370291 13:39738015-39738037 TGCTGCCAGTGCCAGGGATTAGG + Intronic
1113798962 13:113076786-113076808 TGCAGCCTTCCCCAGGCATGTGG - Intronic
1113956599 13:114102782-114102804 TGCCGCCCTCCCCAGGGGTCAGG - Intronic
1117680662 14:58200007-58200029 TGCTGCCGTCGCCAGGACTAGGG - Intronic
1120651088 14:87133611-87133633 TGCTGCCTCCGCCAGAGTCCTGG - Intergenic
1122851779 14:104537280-104537302 TGCTGCCTTCGCCTGCGACTTGG + Intronic
1127441468 15:59013133-59013155 TCCTGCCTTTCCTAGGGATCAGG + Intronic
1128732567 15:70031088-70031110 TGCTGCTTTCTCCAGGGCTGGGG - Intergenic
1131110176 15:89760095-89760117 GGCTGCATCCTCCAGGGATCTGG - Intergenic
1136609872 16:31359731-31359753 TGCTGCCTGAGCCATCGATCAGG - Exonic
1139210511 16:65072239-65072261 TGCTGGCAGTGCCAGGGATCAGG - Intronic
1139366058 16:66434232-66434254 TGGTTCCTTTGCCAGGGGTCGGG - Intronic
1139946808 16:70647391-70647413 GGCTGCCTTCTCCAGGCATCTGG - Intronic
1141068433 16:80932434-80932456 AGCTGCCTTCCCCCGGGAACTGG + Intergenic
1143450643 17:7035048-7035070 TGCTGCTTTCCCCAGTAATCTGG + Intergenic
1144580593 17:16456887-16456909 TCCTGCCATCTTCAGGGATCGGG - Intronic
1145736694 17:27238145-27238167 GGCTGCCTTCCCCATGGAGCAGG + Intergenic
1148898072 17:50852075-50852097 TGTTGCCTTGGCCAGGGGTAGGG + Intergenic
1151619587 17:75237770-75237792 TGCTGCCATCCCCAGGGAGGTGG - Exonic
1152310074 17:79544669-79544691 GGCTGCCTTCCCCAGGGCTCAGG + Intergenic
1152574733 17:81135018-81135040 TGCTGCCTCTGCCAGGCAGCAGG + Intronic
1153988434 18:10373912-10373934 TGCTGCCTCCTCCAGGGACCTGG + Intergenic
1157281155 18:46347155-46347177 TGCTGCCTTGGGGAGTGATCGGG + Intronic
1160538246 18:79606807-79606829 GGCTCCCTCCGCCTGGGATCTGG - Intergenic
1160975809 19:1791907-1791929 TCCTGCCCCCGCCAGGGAGCTGG - Intronic
1161623704 19:5313258-5313280 TGCTGTTTTTACCAGGGATCAGG - Intronic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
1165390729 19:35537255-35537277 GGCAGCCTTTGCCAGTGATCAGG + Intronic
926231826 2:11010203-11010225 TGCTGCCTGCCCCAGAGCTCTGG - Intergenic
927505286 2:23609395-23609417 TGCTGCCTTCTCCAGTGAAAGGG - Intronic
927908066 2:26876215-26876237 TGCTGCCTTGTCCAGGGCCCTGG + Intronic
929141032 2:38666671-38666693 TCCAGCCTTCTCCAGGTATCAGG - Intronic
932844793 2:75124062-75124084 GGCTGCCAGCGACAGGGATCTGG + Intronic
933252973 2:80049615-80049637 TGCTGCCTTTGCCAGGCACCAGG + Intronic
935224296 2:101039680-101039702 TGCTTCCATTGACAGGGATCAGG - Intronic
936556283 2:113500552-113500574 TGCGGACTTGGCCAGGGAACTGG - Exonic
946449729 2:219769424-219769446 TGCTGCTTTCTGCAGAGATCTGG + Intergenic
948445030 2:238025935-238025957 TTCTGCCCATGCCAGGGATCAGG - Intronic
948768741 2:240236564-240236586 TCCTGCTGTCCCCAGGGATCTGG - Intergenic
1172649430 20:36492450-36492472 GGCTGCCTAGGCCAGGGCTCAGG + Intronic
1173856504 20:46253595-46253617 TGCTGCCACCTCCAGGGATCCGG + Intronic
1176044253 20:63084182-63084204 TGCAGCCTTCACCTGGGATTGGG - Intergenic
1176231576 20:64035832-64035854 TGCTGCCTCTCCCAGGGATCTGG - Intronic
1176289599 21:5037114-5037136 TCCTGCCTGCCCCAGGGCTCAGG + Intronic
1179162437 21:38909459-38909481 AGGTACCTTCGGCAGGGATCTGG - Intergenic
1179709240 21:43203343-43203365 TGCTGCATGGGCCAGGGAGCTGG - Intergenic
1179867631 21:44226473-44226495 TCCTGCCTGCCCCAGGGCTCAGG - Intronic
1180078835 21:45477230-45477252 TGTTGCCTTTGCCTGGGAGCTGG + Intronic
1182332429 22:29560821-29560843 TTGTGCCTTCTCCAGGGCTCGGG - Exonic
1182393996 22:30022214-30022236 TGCTTCCTTGGCCAGGGGTATGG - Intronic
1182471221 22:30549551-30549573 TGCTGTCTTTGCCAGGGAAATGG + Intergenic
1183932880 22:41246213-41246235 TTCTGGCTCCGCCAGGGAGCCGG + Exonic
1185327711 22:50235197-50235219 TGCTGCCGTGGACAGGGATGTGG - Intronic
949386300 3:3506052-3506074 TGCTGCCATTGCCGGGGATAGGG + Intergenic
950450338 3:13061654-13061676 TGGTGCCTAAGCCAGGGATCTGG + Intronic
953419830 3:42745962-42745984 TCCTATCTTCGCCAGGGACCTGG - Exonic
953710215 3:45263675-45263697 TGCTGTCTTTTCCAGGGAGCAGG - Intergenic
954325589 3:49861644-49861666 AGCTGCCTACGCCAGGCAGCTGG + Intronic
954443578 3:50534739-50534761 AGCTGCCTTGGCCAGAGATGAGG - Intergenic
955373661 3:58375482-58375504 TGCTGTCTTAGCCCGGGATATGG - Intronic
960613782 3:119579357-119579379 TGCCGCCCTTGCCAGGGTTCTGG - Exonic
961412534 3:126733168-126733190 TGCTGCCTTCGCCCGTGGGCAGG - Exonic
962105354 3:132383423-132383445 TTCTGCCTGCTCCAGGGAGCAGG + Intergenic
968699163 4:2046709-2046731 GGCTGCCTGGGCCAGGGCTCTGG + Intergenic
968951891 4:3699741-3699763 TGCTGCCTTCTCCTGGCACCCGG - Intergenic
969245941 4:5933029-5933051 TGCTCCCAGCACCAGGGATCAGG + Intronic
969491462 4:7501482-7501504 TGGTGCCTTCGCCCTGGAACTGG - Intronic
971991282 4:33898207-33898229 TGCTGCCTTCTCCAGGATACAGG - Intergenic
983875076 4:172866059-172866081 TACTGCCTTCACCTTGGATCAGG + Intronic
985302087 4:188500864-188500886 TGCTTCCTTCTTCATGGATCTGG + Intergenic
985777770 5:1853863-1853885 TTCTGCCTTTCCCAGGGGTCAGG + Intergenic
986418157 5:7549282-7549304 TGCTGCCTTCGCCAGGGATCTGG - Intronic
986658936 5:10041807-10041829 TTCTGCCTTCACAAGTGATCTGG + Intergenic
987060697 5:14240665-14240687 TGCTGCCTTCTCCAGAGAGATGG + Intronic
987082545 5:14438637-14438659 TGGTGGCATGGCCAGGGATCTGG - Intronic
992787114 5:80181034-80181056 TTCTGCCTTCTCCAGGGGTGTGG + Intronic
1000166952 5:158659304-158659326 TGCCTTCTTCCCCAGGGATCTGG - Intergenic
1003561399 6:7183688-7183710 TCCTTTCTTCTCCAGGGATCTGG + Intronic
1004887332 6:20063684-20063706 TGTTGCCTTCTCCAGGGTACTGG + Intergenic
1007257061 6:40536822-40536844 GGGTGCCTTCGCCAGGGGCCAGG - Intronic
1007393120 6:41561901-41561923 TGCTCCCCTAGCCAGGGTTCAGG + Intronic
1007515970 6:42411678-42411700 AGCTGCCCTCACCAGGGATGAGG + Intronic
1009881920 6:69578950-69578972 TCCTTCCTTAACCAGGGATCAGG - Intergenic
1017758939 6:157553168-157553190 GCCTGCCTTCGCCTGGAATCTGG - Intronic
1018197674 6:161369013-161369035 TGCTGCCAGCCCCAGGGACCTGG + Intronic
1018802532 6:167235502-167235524 TCCTGCCTGCGCCATGGAGCTGG + Intergenic
1018882057 6:167893821-167893843 TGCTGCCTTCACCTGGGTCCTGG + Intronic
1019622216 7:1998163-1998185 TGCTGGCTTCTCCAGATATCTGG - Intronic
1021549105 7:21851051-21851073 TTCTGCCTTCCCCAGTGATATGG + Intronic
1022507468 7:30915853-30915875 TGCTGCCTCCTCCAGAGCTCAGG + Intronic
1023755037 7:43408342-43408364 TGTTGCCTTTGCCAGGGGTTAGG + Intronic
1023865473 7:44236227-44236249 TGCTGCCTCCTCCATGGCTCTGG + Intronic
1023971144 7:44991940-44991962 TGCTGCCTTCTCCATTGATAAGG + Intergenic
1026005522 7:66597415-66597437 TGGATCCTTGGCCAGGGATCTGG + Intergenic
1026012579 7:66648275-66648297 TGGATCCTTTGCCAGGGATCGGG - Intronic
1027230645 7:76270112-76270134 TGCTGCGTTCCCCAGGAAGCTGG + Intronic
1034075546 7:148227541-148227563 AGCTGCCTCAGCCAGGGAGCAGG + Intronic
1034219630 7:149433647-149433669 TGGTGCCCACCCCAGGGATCAGG + Intronic
1035060925 7:156069034-156069056 TGCTGCCTGCCCCAGTGTTCCGG + Intergenic
1036222751 8:6934393-6934415 TGCTTCCTTCTCCTGGGCTCTGG + Intergenic
1036224849 8:6949183-6949205 TGCTCCCTTCTCCTGGGCTCTGG + Intergenic
1037754153 8:21700602-21700624 TGCTGTCTTCACCAGGCCTCTGG + Intronic
1044802040 8:95966993-95967015 TGCTCCTTTCCCCAGGGTTCTGG + Intergenic
1045278997 8:100732694-100732716 TCCTGCCTTGGCCTGGGATTGGG - Intergenic
1048309253 8:133305725-133305747 TGCCGCCATCACCTGGGATCTGG + Intergenic
1049791589 8:144474903-144474925 TGGAGCCTTCGCCAAGGACCTGG - Exonic
1050614096 9:7383527-7383549 TGCTGCCTTGGCCAGGTCTTGGG + Intergenic
1051279070 9:15423128-15423150 TGCCGCGGTGGCCAGGGATCTGG + Exonic
1051920245 9:22256696-22256718 TGGTGCCTTCGCCTGCCATCAGG - Intergenic
1056756407 9:89384846-89384868 TGCTGCCATGGCCATGGAGCTGG + Intronic
1057388988 9:94627537-94627559 CGCTGCATTCGCTAGGGCTCAGG - Intronic
1057458348 9:95235324-95235346 TGCTACCTTCGTCATGCATCAGG - Intronic
1061001702 9:127906325-127906347 AGCTGCCAGCTCCAGGGATCAGG - Intergenic
1189193810 X:39134789-39134811 TGGGGCCTTTGCCAGGGAACTGG + Intergenic
1189918708 X:45882468-45882490 TTCAGCCTTCCCCAGGGCTCAGG + Intergenic
1198146973 X:133867620-133867642 TGGGGCCTTTGCCAGGGAACCGG - Intronic
1198687935 X:139247673-139247695 GGCTGCCTTATTCAGGGATCTGG + Intergenic