ID: 986421124

View in Genome Browser
Species Human (GRCh38)
Location 5:7584096-7584118
Sequence GTAATGTTCCACATCTTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 6, 3: 36, 4: 246}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986421124 Original CRISPR GTAATGTTCCACATCTTTAT AGG Intronic
900433586 1:2615138-2615160 GTTATGCTCCACATCCTTAGAGG - Intronic
903977096 1:27157523-27157545 GTAATGTTCTATTTCTTTACTGG + Intronic
905498191 1:38413124-38413146 TAAATGTTCAATATCTTTATTGG + Intergenic
905888634 1:41505687-41505709 GTCATGATCCACATCTATAAGGG - Intergenic
906593351 1:47049178-47049200 GAAATGTTTCACATTTTTTTAGG - Intronic
906912048 1:49963736-49963758 GTTATGTACCACATATTCATGGG - Intronic
907153678 1:52312408-52312430 TTCATGTTCCACATCCTTATGGG - Intronic
907855486 1:58299686-58299708 GGAATGTAACACATCTTTCTGGG + Intronic
908210132 1:61891839-61891861 GAAATGTTCCTTATCTTCATTGG - Intronic
909759810 1:79272445-79272467 GGATTCTTCCTCATCTTTATGGG - Intergenic
909806408 1:79877901-79877923 GTAATGTTCCCCTTCTCTCTAGG - Intergenic
910347881 1:86261939-86261961 GAAATGTTCTATATCTTGATTGG + Intergenic
913048400 1:115093172-115093194 GTAATATTCTATATCTTAATAGG - Intergenic
915410686 1:155699534-155699556 GTAATGTTAAACATCTTTTCAGG + Intronic
916491513 1:165306413-165306435 GTATTGTTCCACATTCTTTTTGG - Intronic
917658202 1:177148685-177148707 GTAATGCACCATCTCTTTATAGG - Intronic
917857358 1:179111668-179111690 GTAATGTTAAACATGGTTATTGG + Intronic
917872575 1:179255151-179255173 GTAAAGTACCACATCTTTATAGG - Intergenic
917993068 1:180403238-180403260 GCAATGTTCTATATCTTGATAGG + Intronic
918436839 1:184523126-184523148 GTAATGTTCCACCTCCTCAAGGG - Intronic
918530180 1:185510991-185511013 GGAATATTCTACATCTTTATTGG - Intergenic
921773106 1:219066730-219066752 GAAATGTTGCACATGTTTAAAGG - Intergenic
922175847 1:223196857-223196879 GTAATGTTCTATATCTTGCTAGG - Intergenic
923197730 1:231684436-231684458 GTAATGTTCCATTTCTTAAGTGG - Intronic
923316650 1:232786821-232786843 GTAGTGTGCTACATTTTTATAGG + Intergenic
923526090 1:234773797-234773819 GTAATGTTTTTTATCTTTATCGG + Intergenic
924078409 1:240365964-240365986 CACATTTTCCACATCTTTATGGG - Intronic
924877662 1:248122966-248122988 GCATTGTTCAACATATTTATGGG + Intergenic
1064125209 10:12653620-12653642 ATAATGTTCCTCATCATTCTGGG - Intronic
1064881359 10:20058155-20058177 GTAATATTTTACATATTTATGGG + Intronic
1066123609 10:32316699-32316721 GTAATGTTCTCTATCTTGATGGG + Intronic
1066328203 10:34387854-34387876 GTAATGTTCCATTTCTTGAATGG + Intronic
1067576299 10:47410761-47410783 GTAACATTCCACATCTTCACAGG - Intergenic
1071500557 10:86200809-86200831 GTATCTTTTCACATCTTTATGGG - Intronic
1072344724 10:94492784-94492806 GGAATGTTCTATATCTTGATTGG + Intronic
1072679513 10:97496688-97496710 GTAATGTTCTATATCTTCGTAGG + Intronic
1074065590 10:110009547-110009569 ATAATGTTCCAGTTATTTATAGG - Intronic
1075786733 10:125055039-125055061 TTAATGTTCCCCAGATTTATGGG - Intronic
1075821743 10:125319364-125319386 GAAATTTTCCACATATTTTTAGG + Intergenic
1076115289 10:127891467-127891489 CCAATGTTCCCCATCCTTATGGG + Intronic
1077432235 11:2521664-2521686 TTAAGGTTCCTCAACTTTATTGG + Intronic
1077942717 11:6860367-6860389 GTAATGTTCCACCTCCTTATGGG + Intergenic
1078162359 11:8852591-8852613 GAAATGCTCCACATCTTGATCGG + Intronic
1078521277 11:12065903-12065925 GTTTTGTTACACGTCTTTATTGG + Intergenic
1079834199 11:25311005-25311027 GTAATGTTGTACGTATTTATGGG - Intergenic
1080731593 11:34961405-34961427 GTTATGTGCTACATTTTTATTGG + Intronic
1081991481 11:47339980-47340002 GGAATGTTCCAGATCTTGGTTGG - Intronic
1082869079 11:57927277-57927299 ATAATGTTTTACATATTTATGGG - Intergenic
1084776876 11:71382935-71382957 GGAATGTTCGACATCTTTAATGG - Intergenic
1085817358 11:79753841-79753863 ATAATATTTCACATATTTATGGG - Intergenic
1086185299 11:84006641-84006663 GTAATATTTTACATCTTTATGGG - Intronic
1087397132 11:97613615-97613637 GAAATGTTCCAGATATTTGTTGG + Intergenic
1088292418 11:108254981-108255003 TTAATGTTTCACATTTTTAATGG + Intronic
1089058180 11:115604506-115604528 GTCATGTTCTACACCTTAATAGG + Intergenic
1090527201 11:127549597-127549619 CTAGTTTTCCACATTTTTATTGG - Intergenic
1093280329 12:17186503-17186525 GAAATGTTCTATATCTTAATTGG - Intergenic
1095666124 12:44800747-44800769 GGAATTTTCAACAGCTTTATAGG + Intronic
1096014702 12:48259495-48259517 GAAATGTTCTACATCTTCATTGG - Intergenic
1096468392 12:51861261-51861283 TCAATATTCCACATCTTGATTGG + Intergenic
1096878983 12:54652209-54652231 GTAATGCTTCATATCTTGATTGG - Intergenic
1097552282 12:61089733-61089755 GTCATGTTCCACATGTTAAAGGG + Intergenic
1097722200 12:63034153-63034175 GTAATGTTCTATATCTTAGTAGG + Intergenic
1098499358 12:71172427-71172449 TTAATGATCCACATCCTTATTGG + Intronic
1099306853 12:80968083-80968105 GTAACGTTCCACCTCTTTGAGGG + Intronic
1099788074 12:87293607-87293629 ATGATGTTGCACATCTTTTTAGG - Intergenic
1100157170 12:91813682-91813704 ATAATGTTCCAGTTCTTTTTGGG - Intergenic
1100878808 12:98993485-98993507 GAAATGTTCCTCTCCTTTATGGG + Intronic
1100924467 12:99528584-99528606 GTTATGTTCCTCATTTTTAATGG - Intronic
1102272363 12:111548637-111548659 GTACTTTTCCACATCTTGAATGG - Intronic
1103326108 12:120121968-120121990 GCATTGTTCCACATTTTTTTAGG - Intergenic
1104261642 12:127188577-127188599 GTAATTTTCCATATGGTTATGGG + Intergenic
1105052928 12:133070878-133070900 GAAATGTTCTACATCTTGACAGG - Intergenic
1105435114 13:20370098-20370120 GAAATGTTCCATGTCTTGATTGG + Intergenic
1107334520 13:39339860-39339882 GAAATGTTCTACATATTGATTGG - Intergenic
1107776744 13:43851998-43852020 CTTATGCTCCTCATCTTTATGGG - Intronic
1110291941 13:73817885-73817907 CTAATTTTGCACATCTTAATTGG - Intronic
1111359311 13:87153979-87154001 ATTATTTTTCACATCTTTATAGG - Intergenic
1112083595 13:96004236-96004258 GAAAAGTTGCACATATTTATGGG + Intronic
1114870857 14:26656871-26656893 GTAATGCTCCACACCTTTATAGG - Intergenic
1114893381 14:26954081-26954103 TTAATGCTCCAGATGTTTATAGG - Intergenic
1115097765 14:29658776-29658798 GTAATATGCCACATCATTCTGGG - Intronic
1115570481 14:34661726-34661748 GTAAGGGGCCACTTCTTTATAGG - Intergenic
1115694227 14:35879130-35879152 GGAATGTTCCACATTTTTTGTGG - Intronic
1115729492 14:36253052-36253074 GTAATGTTCTATATCTTGACAGG + Intergenic
1115789572 14:36863967-36863989 ATAATGTTCCACCTCTCTTTGGG - Intronic
1116358298 14:43959234-43959256 GTAATGTTCTACATGAATATAGG - Intergenic
1117183726 14:53218072-53218094 GTAATGTTCTATATCTTGATAGG - Intergenic
1118583300 14:67326564-67326586 GAAATGTTCTAAATCTTGATTGG - Intronic
1119403890 14:74383613-74383635 GTAATGTTTTATATCTTGATAGG + Intergenic
1120374793 14:83690244-83690266 GTACTGTTCCTCATCTTAAGGGG + Intergenic
1121398492 14:93649915-93649937 GTAATGTTCTCTATCTTTACAGG - Intronic
1122395313 14:101424154-101424176 GTAATGTTCTACATCTGGCTAGG + Intergenic
1124691797 15:31829522-31829544 GGAATGTTTGACATCTTTATTGG - Intronic
1124951110 15:34322014-34322036 GTAATATTCTACATCTTGATGGG + Intronic
1125853783 15:42929947-42929969 ATAATGTTCTATATCTTAATAGG + Intergenic
1126434315 15:48620262-48620284 GTAATGTTACACATCATTGAGGG + Intronic
1130419958 15:83735438-83735460 GTCAAGTTCCTCATCTTTGTGGG - Intronic
1134378630 16:13703148-13703170 GAAATCTTCCACATTTTGATTGG + Intergenic
1143892175 17:10110971-10110993 GTAATGTTTTACATATTTATGGG - Intronic
1144601775 17:16621855-16621877 GTAATGCACAACATTTTTATAGG - Exonic
1146114226 17:30119987-30120009 GAAATGTTCTAAATCTTGATTGG - Intronic
1147019207 17:37517544-37517566 AAAATGTTCCACACCTTTCTTGG + Exonic
1147349825 17:39833351-39833373 GTAATGTTCTGTATCTTGATAGG - Intronic
1148696036 17:49558932-49558954 GTAATGTTCCCCCTCTTTTAAGG - Intergenic
1153354426 18:4119745-4119767 ATAGTGATCCACATCTTTGTGGG - Intronic
1153519226 18:5936450-5936472 GTAATATTTTACATCTGTATAGG - Intergenic
1154956017 18:21255592-21255614 GCAGTGTTCTTCATCTTTATTGG - Intronic
1155278119 18:24209913-24209935 GAAATGTTCCACATCTTGAATGG + Intronic
1157878684 18:51297981-51298003 GTAATGTTCTATATCTTAATAGG - Intergenic
1159014881 18:63093139-63093161 GTAATGTTCCCCAACCTTTTTGG - Intergenic
1159413638 18:68114715-68114737 TTAACGATCCACATTTTTATTGG - Intergenic
1159689129 18:71463673-71463695 GAAATGTTCTATATCTTAATTGG + Intergenic
1162460905 19:10813377-10813399 ATAATGTTTGACATATTTATGGG + Intronic
1164411861 19:28012788-28012810 AAAATGTTCCACATCTTTGTTGG + Intergenic
1164516880 19:28944098-28944120 AAAATGTTCCATATCTTTGTTGG + Intergenic
1164753651 19:30673762-30673784 GTCAGGTTCCCCATGTTTATAGG + Intronic
926696545 2:15773125-15773147 GAAATGTTCTTCATCTTCATGGG + Intergenic
927455359 2:23244128-23244150 GTAATTTTCCCCTTCTTTTTAGG - Intergenic
930423585 2:51184207-51184229 GAAATTTTTCACATATTTATTGG + Intergenic
930587634 2:53287540-53287562 GTAATCTTTCAAATATTTATGGG - Intergenic
933863467 2:86494206-86494228 GTCTTGTTCCTCATCTTTAGGGG + Intergenic
935514452 2:104019412-104019434 AGATTCTTCCACATCTTTATGGG + Intergenic
936963048 2:118096993-118097015 GAAATGTTCCACAGCTGGATTGG - Intronic
939515341 2:143160328-143160350 GTTTTGTTCCTAATCTTTATTGG + Intronic
941302645 2:163823250-163823272 GTCATGTTCCAGATCTTAAAGGG + Intergenic
941419970 2:165271669-165271691 GAAATATTCTACATCTTAATTGG - Intronic
941519789 2:166526586-166526608 TTAACCTTCCACATTTTTATTGG - Intergenic
941675021 2:168334551-168334573 GTAATATTTTACATATTTATGGG - Intergenic
941975734 2:171403100-171403122 GTTATGTTCCACTTCCTTAAGGG - Intronic
942227167 2:173827245-173827267 GTAATATTCTATATCTTGATAGG + Intergenic
942256175 2:174100776-174100798 GAAATGTTCCATATCTTTGTGGG - Intronic
942692166 2:178597403-178597425 ATAATGTTCAACATGATTATGGG + Intronic
943199882 2:184808047-184808069 GTAATATTCCTTAACTTTATGGG + Intronic
944375844 2:199041140-199041162 ATAATGTTCCAGATGTTTTTGGG + Intergenic
945171419 2:207000815-207000837 GAAATGTTCTATATCTTGATTGG + Intergenic
945254756 2:207794237-207794259 AAAATGTTCCATATCTTGATAGG + Intergenic
945750009 2:213769858-213769880 GCAATGTTCCATGTCTTGATAGG - Intronic
946268702 2:218570782-218570804 GTAATGTACCACAGCTTTAATGG - Intronic
947008800 2:225542336-225542358 GTCATGTTCCAGATCTTTAGAGG + Intronic
948441977 2:237998245-237998267 GAAATGTTTTTCATCTTTATTGG - Intronic
1169587959 20:7107650-7107672 GAAATATTCTAGATCTTTATTGG + Intergenic
1170308464 20:14966294-14966316 GGCATGTTCCATATCTTCATCGG - Intronic
1172041439 20:32049375-32049397 GAAATGTTCTATATCTTGATTGG + Intergenic
1174314720 20:49689786-49689808 GTAATGTTTCATATCTTGATAGG - Intronic
1175738773 20:61406074-61406096 AAAATCTTCCACGTCTTTATTGG + Intronic
1177364662 21:20118184-20118206 GAAATATTCTACATCTTTATAGG + Intergenic
1181693301 22:24578547-24578569 GCACTGTTCCAATTCTTTATGGG - Intronic
1182194471 22:28501659-28501681 GTAATATTTTACATATTTATGGG - Intronic
1182264014 22:29098345-29098367 GTTTTGTTGAACATCTTTATAGG + Intronic
1184311688 22:43649438-43649460 GTAATGTTTCACATTTCTAGTGG - Intronic
1184655370 22:45938876-45938898 GTAATATTACACATATTTATGGG - Intronic
950637501 3:14325065-14325087 GCACTGTTCAACATCTCTATAGG - Intergenic
950860370 3:16142407-16142429 GAAATGTCCTACATCTTGATAGG + Intergenic
951348100 3:21571109-21571131 AAAATGTTCCATCTCTTTATTGG - Intronic
952386836 3:32847833-32847855 GTAATGTTTTATATATTTATGGG + Intronic
952670410 3:35960243-35960265 GTAATCTACAACATCTTGATAGG + Intergenic
955133334 3:56191659-56191681 GTGATGTGCAACATCTTTCTAGG - Intronic
956208131 3:66775190-66775212 GTAATGTTCTGTATCTTTGTAGG + Intergenic
957325287 3:78684429-78684451 GAAATGTTCCATATCTTGATCGG + Intronic
958117236 3:89235975-89235997 GAAATGTTCCATATCATTAGTGG + Intronic
959397072 3:105854230-105854252 GTTATATGCCACATGTTTATAGG - Intronic
959769404 3:110074025-110074047 GAAATGTTCGATATCTTTATAGG - Intergenic
959847178 3:111046857-111046879 GTACTGTTACATATCTTCATTGG - Intergenic
960760198 3:121064683-121064705 GAGATGTTCCACATTTTTTTAGG + Intronic
962152573 3:132908372-132908394 GAAGTGTTCCACATCTTTATTGG - Intergenic
963134842 3:141892808-141892830 GTAATGTTCTATATCTTTAATGG + Intronic
964359590 3:155880592-155880614 GAAATGTTCTATATCTTGATTGG - Intronic
964885799 3:161480871-161480893 GTAATGTTCTATATGTTTACAGG + Intergenic
965504804 3:169502708-169502730 TTAAAGTTCAACATCATTATAGG + Intronic
966954089 3:184855514-184855536 GTAATGTTCTACATCTTGATAGG - Intronic
967538587 3:190637704-190637726 GTAATATTCTATATCTTAATAGG - Intronic
967670575 3:192229753-192229775 ATAATGTTCCAAAGCTGTATAGG - Intronic
967946375 3:194807354-194807376 GTAATTTTCCAAAGCTTTAGAGG + Intergenic
971459104 4:26874438-26874460 GAACTGTGGCACATCTTTATTGG + Intronic
971668421 4:29524067-29524089 ATAATGTTACTCATCTTTGTTGG - Intergenic
972114648 4:35616198-35616220 GAAATGTTCTACATCTTCATTGG - Intergenic
973609555 4:52622221-52622243 TTAATGTTCCATTTTTTTATAGG + Intronic
974468106 4:62283711-62283733 GAAATGTTCTATATCTTGATTGG + Intergenic
974761589 4:66283057-66283079 GTAATTTTCTACATCTCTAATGG + Intergenic
976354355 4:84098870-84098892 GTTATGTTCTATATCTTGATAGG + Intergenic
977898534 4:102392533-102392555 GCACTGTTCCACTTCTTTAAAGG - Intronic
978720839 4:111907149-111907171 GTAATGTTGCATATCTATATCGG + Intergenic
979851831 4:125580721-125580743 GTAATGTTCTCCATGTTTAAGGG + Intergenic
980063914 4:128161297-128161319 GTAATGCTCCACACATTTGTAGG + Intronic
980973288 4:139586882-139586904 GAAATGTTCTACATCTTGATTGG - Intronic
981291663 4:143083483-143083505 GTAATGCTCAAGATCTTTATAGG + Intergenic
981412160 4:144444523-144444545 GTAATATTTTACATATTTATTGG - Intergenic
981995700 4:150972552-150972574 GTAATATTTTACATATTTATGGG - Intronic
982107751 4:152025494-152025516 GTAAGGTTCCAAATCTTGGTAGG + Intergenic
982375928 4:154690496-154690518 GTAATGTTTCATTTCTTCATGGG - Intronic
982919889 4:161259698-161259720 TAAATGTTTCACATCTTTGTTGG + Intergenic
983854726 4:172629751-172629773 GGAATGTTCTACATCATCATTGG - Intronic
984118742 4:175715293-175715315 ATAATTTCCCACATCTTCATGGG + Intronic
984272478 4:177564467-177564489 GTAATGTTCCACCTCCTTGAAGG + Intergenic
984439883 4:179753775-179753797 ATACTGTTCCTCATATTTATAGG - Intergenic
986421124 5:7584096-7584118 GTAATGTTCCACATCTTTATAGG + Intronic
987942179 5:24553754-24553776 ATTAGGTTCCACATCTTGATGGG - Intronic
988494475 5:31733233-31733255 GTGATGTTCCAATTCTTGATGGG + Intronic
988965734 5:36415908-36415930 GTAATATTCTACATTTTTATTGG + Intergenic
989783480 5:45298724-45298746 GTATTGTTCCACTTCCTTAAAGG - Intronic
991106242 5:62845329-62845351 ATAATGTTTTACATATTTATGGG + Intergenic
991395617 5:66202217-66202239 GTAATGATCAACATATGTATAGG - Intergenic
991602455 5:68367179-68367201 ATAATCTTCAACATCATTATGGG + Intergenic
992041598 5:72839624-72839646 GTAATGTTTCCCATATTAATCGG + Intronic
992850900 5:80806528-80806550 TTAAGTTTCCACATTTTTATGGG + Intronic
993913199 5:93709171-93709193 GCATTGTTCCTCAGCTTTATTGG - Intronic
994010962 5:94901660-94901682 GGAATATTCATCATCTTTATGGG + Intronic
996154902 5:120086623-120086645 TTATTGTTCCACATCCTTAAAGG - Intergenic
996445018 5:123537777-123537799 GAAATGTTCTATATCTTAATTGG - Intronic
997057785 5:130465511-130465533 GTAATATTCTATTTCTTTATAGG - Intergenic
1000501659 5:162058844-162058866 GTAATATTCCACATTTTTATAGG - Intergenic
1000804641 5:165774804-165774826 TGAATGTTCCACATCACTATGGG - Intergenic
1000965952 5:167656839-167656861 ATAATGTTATACATATTTATAGG + Intronic
1001151376 5:169231112-169231134 GCAATGTCCCATATCTGTATGGG + Intronic
1001446597 5:171789832-171789854 GAAATGCTCTACATCTTGATTGG + Intronic
1004066824 6:12254506-12254528 GATATGGTCCACAGCTTTATGGG - Intergenic
1004183192 6:13398386-13398408 GAAATGTTCCAAATCTTGATTGG + Intronic
1004955495 6:20723642-20723664 GGAATGTTCACCATGTTTATAGG + Intronic
1006014447 6:31068490-31068512 TCAATGTTCCACATCTTCTTTGG + Intergenic
1006576016 6:35046854-35046876 GTAATGTTCAGTATCTTGATAGG - Intronic
1008008975 6:46443630-46443652 GTAATGTTCAAAATTTTTAGAGG - Intronic
1008387599 6:50911307-50911329 GAAATGTTCCAACTCATTATTGG - Intergenic
1008423688 6:51332086-51332108 ATAATGCTCCAGATCTTTACAGG - Intergenic
1009286500 6:61825668-61825690 ATAATGTGCCACACCCTTATGGG - Intronic
1009295764 6:61944765-61944787 GTAATATTTTACATATTTATAGG - Intronic
1009549890 6:65076404-65076426 ATAATGTTACAAACCTTTATAGG + Intronic
1009934772 6:70220911-70220933 GGAATATTCAACATATTTATAGG - Intronic
1011337088 6:86273390-86273412 GCAATCTTCCACTTCTTTAGAGG - Intergenic
1013065526 6:106681404-106681426 GTAATATTTTACATATTTATGGG - Intergenic
1013916959 6:115352157-115352179 CTTTTATTCCACATCTTTATGGG - Intergenic
1014397016 6:120936716-120936738 CTAATCTTCCTAATCTTTATGGG + Intergenic
1014884156 6:126759197-126759219 GAAAAGTTCCTCATCTTTAATGG + Intergenic
1015985833 6:138883235-138883257 TTAATCATCCACATCTTTCTTGG + Intronic
1016398919 6:143657327-143657349 GAAATATTCTACATCTTGATAGG - Intronic
1017288018 6:152700992-152701014 GTATTATTCCACAACTATATAGG - Intronic
1018948184 6:168361311-168361333 GTAATGTTGAACATCTTTTCAGG - Intergenic
1020698236 7:11443737-11443759 GTAATATTATACATATTTATGGG + Intronic
1021439081 7:20657666-20657688 GAAATGTTCTATATCTTTATTGG + Intronic
1023260306 7:38351799-38351821 GTATTATTTCACAACTTTATAGG - Intergenic
1023767815 7:43528338-43528360 GTAATGTTCTCTATATTTATGGG + Intronic
1024478144 7:49835629-49835651 GTAATTTTCCATTTCTTCATAGG - Intronic
1027912498 7:84269304-84269326 GCCATGTTTCACATTTTTATAGG - Intronic
1028056247 7:86248149-86248171 GAAATATTCCAAATCTTTCTTGG - Intergenic
1029573751 7:101389200-101389222 GTGATGTTGAACATCTTTTTAGG + Intronic
1030088015 7:105833572-105833594 GTAATGTTCTATATCTTAATAGG + Intronic
1030339412 7:108359803-108359825 GAAATGTTCTATATCTTGATTGG - Intronic
1031111866 7:117620433-117620455 GGATTATTCCACATCCTTATAGG + Intronic
1032565390 7:132936709-132936731 GTAATTATCCACATCCTTTTTGG - Intronic
1033203684 7:139397337-139397359 GCAATGTTCCCCATTATTATGGG - Intronic
1033525404 7:142208700-142208722 GTAATATCCCACATCTTAATAGG + Intronic
1033551062 7:142448588-142448610 GAAATGTTCGGCATCTTAATAGG - Intergenic
1037020425 8:13963349-13963371 TTAATGTCCAACATCTTCATGGG + Intergenic
1038338783 8:26666700-26666722 GAAATGTTCTATATCTTAATTGG - Intergenic
1038949647 8:32400525-32400547 GTAATTTTCCATATGCTTATTGG - Intronic
1039760586 8:40570277-40570299 AAAATGTTCTACATCTTGATTGG + Intronic
1040744811 8:50628868-50628890 GTAATATTCTACATGTTGATAGG - Intronic
1040761915 8:50857489-50857511 GAAATGTTCTATATTTTTATTGG + Intergenic
1042148896 8:65760276-65760298 GTGATGTTACATATATTTATTGG - Intronic
1046896885 8:119482788-119482810 GAAATATTCCATATCTTAATTGG + Intergenic
1051157331 9:14164548-14164570 GTCATGTACCACATCATGATAGG - Intronic
1051776966 9:20644986-20645008 GAATTGTTTCACATATTTATTGG + Intergenic
1052128973 9:24817292-24817314 GTTATATTCCAAGTCTTTATTGG + Intergenic
1052579154 9:30331571-30331593 TTATTGTTGCACATCTTTTTAGG - Intergenic
1054859975 9:69940690-69940712 GTTAAGTTCCACATATTTGTAGG - Intergenic
1055217924 9:73889906-73889928 GAAATGTTCTACATCTTCACAGG + Intergenic
1056644833 9:88401889-88401911 ATAATATTTTACATCTTTATGGG + Intronic
1057894577 9:98898373-98898395 GAAATGTTCTACATCTTGATAGG + Intergenic
1058444480 9:105042522-105042544 GTAAGTTTCCACATATTTGTTGG + Intergenic
1058622167 9:106895132-106895154 ATAATATTCCATACCTTTATTGG + Intronic
1059791283 9:117643962-117643984 GTTATTTTCCAGATATTTATTGG + Intergenic
1186516250 X:10167878-10167900 GTAATGGTCCAAAGCTTTCTTGG + Intronic
1186969381 X:14823770-14823792 GAAATGTTCTATATCTTGATTGG - Intergenic
1188070368 X:25710933-25710955 GTAATGTTTTATATCTTGATTGG - Intergenic
1188197970 X:27262622-27262644 GAAATGTTTCATATCTTGATAGG + Intergenic
1189677728 X:43479233-43479255 GTAATGTTCTATATCTTGATGGG + Intergenic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1190866485 X:54389156-54389178 GTAATGTTCTGTGTCTTTATAGG - Intergenic
1192861602 X:75079069-75079091 GTAAAATTGCACAACTTTATTGG - Intronic
1194416288 X:93616399-93616421 GTAATGTTTTGTATCTTTATGGG - Intergenic
1195612681 X:106886677-106886699 GAAATGTTCTATATCTTGATTGG - Intronic
1195620254 X:106946090-106946112 GTATTTTTCAACATCTTTACTGG + Intronic
1197053475 X:122089636-122089658 GCAATGTTCTGCATCTTGATTGG + Intergenic
1197294853 X:124706400-124706422 GGAATGTTATACATCTTGATAGG - Intronic
1197654002 X:129096444-129096466 ATAATGTTCTAAATCTTTATAGG - Intergenic
1197688703 X:129473842-129473864 GAAATGGTCTATATCTTTATAGG + Intronic
1197865621 X:131013716-131013738 GAAATGTTCTACATTTTTATAGG - Intergenic
1197972229 X:132127071-132127093 GAAAAGTTCTACATTTTTATTGG - Intronic
1198483957 X:137067700-137067722 GAAATGTTCTATATCTTGATAGG + Intergenic
1199499004 X:148488485-148488507 GTAATGTTCCACTCCTTTCCAGG - Intergenic