ID: 986422873

View in Genome Browser
Species Human (GRCh38)
Location 5:7601696-7601718
Sequence CAGAGTGAAGAGAAGAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 851
Summary {0: 1, 1: 0, 2: 3, 3: 75, 4: 772}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986422873_986422878 17 Left 986422873 5:7601696-7601718 CCTTCATTCTTCTCTTCACTCTG 0: 1
1: 0
2: 3
3: 75
4: 772
Right 986422878 5:7601736-7601758 TCTCCTTCCCATCCTTCCTTAGG 0: 1
1: 0
2: 3
3: 67
4: 475

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986422873 Original CRISPR CAGAGTGAAGAGAAGAATGA AGG (reversed) Intronic
900337198 1:2170090-2170112 CAGGGTGAAGAGCAGAACCAGGG - Intronic
900474557 1:2869996-2870018 CAGAGGGAAGAGGAGGATGAAGG + Intergenic
901359961 1:8689211-8689233 CAGAATGAAGGGCAGAATTAAGG + Intronic
901549184 1:9982630-9982652 GAGAGTGAAGACAGGAATGCTGG + Exonic
902342007 1:15789904-15789926 AGGAATGAAAAGAAGAATGAAGG - Intergenic
902697992 1:18153343-18153365 CGGAGTGAAGACAAGACTGTTGG - Intronic
902834171 1:19036008-19036030 CAAAGTCAAGAAAAGATTGAGGG - Intergenic
903520634 1:23945416-23945438 CAGAGGGAAGAGGAAAATTATGG - Intergenic
904240682 1:29142833-29142855 AAGAGTGAAGAGAAGGAGGTTGG - Intergenic
904345717 1:29867554-29867576 TTGAGTGAATGGAAGAATGAAGG + Intergenic
904896963 1:33824743-33824765 CAGAAGGATGAGAAGAACGATGG + Intronic
905003638 1:34693364-34693386 CAGAGTGAAGGGATGGATAAAGG - Intergenic
905099705 1:35508796-35508818 AATAGTTATGAGAAGAATGAAGG - Intronic
905158857 1:36013539-36013561 CACAGTGAAGAAAAAAAAGAGGG + Intronic
905222678 1:36459701-36459723 GAGGGAGAAGAAAAGAATGAAGG + Intronic
905362645 1:37431086-37431108 CAGAGTGGATAGGAGAAGGAGGG + Intergenic
905447134 1:38034773-38034795 CAGGGTGAAGAGAGGCAAGATGG - Intergenic
905884928 1:41486606-41486628 GACCGTGAAGAGAAGAAAGAAGG + Intergenic
905911599 1:41658736-41658758 CAGAGTGAACAGGATAATAAGGG + Intronic
906943041 1:50272651-50272673 CAGTGTGAACAGTATAATGATGG + Intergenic
906967500 1:50472888-50472910 GAGAATTCAGAGAAGAATGAAGG + Intronic
906994621 1:50778662-50778684 CAAACTGAAGAGAAGGAGGAAGG + Intronic
907056432 1:51373099-51373121 CAGGATGTAGAGAAGAAAGAAGG + Intronic
907666496 1:56437647-56437669 CAGACACAAGAGAAGACTGATGG + Intergenic
908464802 1:64382874-64382896 TAGAGTGAATAGAATAATTAGGG - Intergenic
909125658 1:71665638-71665660 AAGAGTTTAGTGAAGAATGATGG - Intronic
909958349 1:81803440-81803462 CAGAGTGAACAGAGGATTGGAGG - Intronic
910220051 1:84880822-84880844 CAGAGGGTACAGAAGAAGGAAGG + Intronic
910524880 1:88166156-88166178 CAGAGAGAAGAGAAGCCTGAAGG + Intergenic
911480912 1:98439355-98439377 AAAAGTGAAGAGAAGAAGGCAGG + Intergenic
911803337 1:102173727-102173749 CATAGGGAGGAGAAGAAAGATGG + Intergenic
911861831 1:102961175-102961197 CAGTGTGCAGATAAGAATAAAGG + Intronic
911957511 1:104256346-104256368 GAGAGAAAAGGGAAGAATGAAGG - Intergenic
912227741 1:107754699-107754721 GAGAGTGAAGGGAAGGATGGTGG - Intronic
912425702 1:109587967-109587989 CAGAGAGGAGAGAAAAAAGATGG - Intronic
912468715 1:109892200-109892222 CAGCGTGTAGGAAAGAATGATGG - Intergenic
912573794 1:110645037-110645059 TACATTGAAGAGTAGAATGAAGG + Intergenic
912642314 1:111359442-111359464 CAGGGTGAATTGAAGAGTGAAGG + Intergenic
912723633 1:112040730-112040752 CAGAGGGAACAGAATAGTGATGG - Intergenic
913011272 1:114686259-114686281 GAGAGGGAAGAGAAAAAAGAAGG - Intronic
913404810 1:118477840-118477862 CAGAGGAAAGAGAAGATAGATGG - Intergenic
913419479 1:118649283-118649305 CATTGTCTAGAGAAGAATGAGGG - Intergenic
913531521 1:119737302-119737324 CAGAGGGAGGAGAGGAAGGAAGG + Intronic
915310115 1:155002370-155002392 CAGAGAGAAGGAAAGAAGGAGGG + Intergenic
915831828 1:159138422-159138444 GAGAGTGATGTGATGAATGATGG - Intronic
915982360 1:160428279-160428301 CAGAGGAAAGAGAAGACAGACGG - Exonic
916376199 1:164156134-164156156 AAGAGGGAAGAGATGATTGAAGG - Intergenic
916633180 1:166638522-166638544 CTTAGTGAAGAGAAGAAAGATGG - Intergenic
917042325 1:170819535-170819557 CAGAGGGTGGAGAAGAATTAGGG + Intergenic
917758721 1:178132026-178132048 AAGAGGGAAGGGAAGAAGGAGGG - Intronic
917856917 1:179108580-179108602 AAGGGTAAAGAGAAGAATGGTGG - Exonic
917872842 1:179257128-179257150 CAGAATCAAGAGAAGTAGGATGG + Intergenic
917902009 1:179552043-179552065 AAGAGGAAAGTGAAGAATGAAGG - Intronic
918257351 1:182761340-182761362 CAGAGAGAAGACCAGAAAGAGGG + Intergenic
918508280 1:185281698-185281720 CAGGGTGCAGAGAAGAAAGACGG + Intronic
918558523 1:185835200-185835222 CAGAGTGAAGAGGAGAAGCATGG + Intronic
918606915 1:186438493-186438515 GAGACTGAGGAGAATAATGAAGG + Intergenic
919049091 1:192490599-192490621 CAGAGGTAAGAGAAGAATTCAGG - Intergenic
919204340 1:194401676-194401698 CAGAGTGAGGAGAGGAAAGGAGG + Intergenic
919525662 1:198646817-198646839 AAAAGTAAAGAGAAGAATCAAGG + Intronic
919811258 1:201410268-201410290 CAGAGTCTAGAGGATAATGAGGG - Intronic
919917989 1:202150865-202150887 CAGAGTGGAGAGAAGACTGTGGG - Intronic
920570821 1:207016039-207016061 CAGAAAGAAGAAAAGAAAGAAGG - Intronic
920683703 1:208092926-208092948 CAAAGAGAAGAGAACAAAGAGGG + Intronic
921165290 1:212502562-212502584 AAGGGTGAGGAGAAGAAGGAGGG + Intergenic
921351915 1:214244655-214244677 CAGAGCGGAGAGAGAAATGAAGG - Intergenic
921404857 1:214767524-214767546 AAGAAGGAAGAGAAGAAGGAAGG - Intergenic
921569427 1:216760702-216760724 CAGAGGGATCAGAAGAAGGAGGG + Intronic
922964988 1:229682046-229682068 GAAAGAGAAGAGAAGAAAGAAGG - Intergenic
923010304 1:230083163-230083185 CAGAGTGGGGAGCAGGATGATGG + Intronic
923121817 1:230999089-230999111 CACAGTGAAGGGAAGGAAGAGGG - Intronic
923274761 1:232386406-232386428 CTGAGTGAGGAGAGGAAGGAAGG + Intergenic
923322190 1:232845585-232845607 CAGAGTCAAGGGAAGAAAGATGG - Intergenic
923515073 1:234690282-234690304 GAGAGAAAAGAGAATAATGATGG + Intergenic
923677611 1:236093547-236093569 CTGATTTAAGAAAAGAATGAAGG - Intergenic
923831356 1:237561058-237561080 TATAGGGAAGGGAAGAATGAAGG + Intronic
923929140 1:238673824-238673846 GCGAGTGAAAACAAGAATGAGGG - Intergenic
924095707 1:240548781-240548803 CAGGTTGAAGGAAAGAATGAAGG + Intronic
924689067 1:246327304-246327326 CTGACTGAAGATAAGAAAGAGGG - Exonic
1063221723 10:3975183-3975205 CAGAGAGACCAGAAGAAGGAAGG + Intergenic
1063621735 10:7655573-7655595 CAAAATAAATAGAAGAATGAGGG + Intronic
1064063872 10:12163725-12163747 CAGACTGCAGAGTAGTATGATGG + Intronic
1064986178 10:21212442-21212464 CAGAGTGATGGGAGGAAAGAAGG + Intergenic
1065651499 10:27897172-27897194 CAGAGTGAAGTAAAGAAAGAAGG - Intronic
1065674387 10:28158445-28158467 CCTAGTGAAGAGTAGAATAATGG + Intronic
1066365042 10:34768733-34768755 CAGAGTGCAGAGAAGAAAAGTGG - Intronic
1067878376 10:50024017-50024039 CAGAGGGCAGAAAAGAAAGACGG - Intergenic
1067893346 10:50153911-50153933 CAGAGGGCAGAAAAGAAAGACGG + Intergenic
1067927450 10:50524454-50524476 CACAGTCAAGAGAAGAAAGGAGG - Intronic
1068101862 10:52564936-52564958 AAGAGTGGAGCAAAGAATGAAGG - Intergenic
1068184729 10:53570338-53570360 CAGAGTGAAGAAAATAAGCAAGG - Intergenic
1068264591 10:54630215-54630237 CTAAGTGAAGAGAAGAAAGCTGG + Intronic
1069409654 10:68140208-68140230 CATATTGAAGGGAAGAGTGATGG + Intronic
1070548391 10:77470619-77470641 CAGACAGAAGAGCAGAAAGAAGG + Intronic
1070549919 10:77482957-77482979 GAGAGAGAAGAGAGGAAGGATGG - Intronic
1071366366 10:84904490-84904512 GAGAGAAAAGAGAAAAATGAAGG - Intergenic
1071984529 10:91037118-91037140 CAGAGAGAAGGTAAGAATGTGGG - Intergenic
1072111669 10:92327019-92327041 GAGGGAGAGGAGAAGAATGAAGG - Intronic
1072990205 10:100185765-100185787 CAGCCAGAAGGGAAGAATGAGGG - Exonic
1073074631 10:100816041-100816063 CAGAGGGAAGAGATGAAGGGAGG - Intronic
1074157110 10:110808736-110808758 CAGAGTAAAGGTGAGAATGAAGG - Intronic
1074660751 10:115654516-115654538 CAATGAGAAAAGAAGAATGATGG - Intronic
1074841632 10:117358563-117358585 CAGAGGGAAGAGAAAGATAAGGG - Intronic
1074984439 10:118644385-118644407 CAGAGTGAAGAAAAGAAGTCAGG - Intergenic
1075192782 10:120326326-120326348 CAGAGAGTAGAAAAGAAGGAAGG - Intergenic
1075829896 10:125399721-125399743 CAGAGTAAAGTGAGCAATGATGG + Intergenic
1076555423 10:131318145-131318167 GAGAGGGAAGAGGAGAAGGAAGG + Intergenic
1076650639 10:131984652-131984674 GGGAATGAAGAAAAGAATGAGGG + Intergenic
1076856619 10:133118567-133118589 GAGAGAGAAGGGAAGAGTGAAGG + Intronic
1077345934 11:2053491-2053513 TAGAGGGAAGAGAAGAAGAATGG - Intergenic
1077904938 11:6524352-6524374 CAGAGAGAAGAGATGAAAAAAGG - Intronic
1078060806 11:8041671-8041693 CAGAGTGAGGAGAAAAACTAGGG - Intronic
1078323369 11:10357345-10357367 CAGAGGAAAGAGAAGACAGAAGG + Intronic
1079334900 11:19562683-19562705 CATTGTGAAGAGAAAAATGAAGG + Intronic
1079934541 11:26600526-26600548 GAGAGAGAAGAGGAGAAGGAAGG - Intronic
1080384448 11:31802881-31802903 CAGAGTGAAGAGGAAGAAGAGGG + Intronic
1080447454 11:32350814-32350836 CAGAGTGATGAAAAGAATAAGGG + Intergenic
1080944632 11:36957886-36957908 TAGGGTGAAGAGGAGAAAGATGG + Intergenic
1081266947 11:41036216-41036238 CAGAATGAATTTAAGAATGAAGG - Intronic
1081626457 11:44658890-44658912 GAAAGTGAATAGAATAATGAAGG + Intergenic
1082143609 11:48639516-48639538 AAGAGAGAAAAGAAGAAAGAAGG - Intergenic
1082699234 11:56407624-56407646 AAGAATGAAGATAAGAATAAAGG + Intergenic
1083140256 11:60715544-60715566 TAGACTGAATTGAAGAATGAAGG - Exonic
1083614961 11:64021701-64021723 CAAGGGGAAGAGGAGAATGAAGG - Intronic
1083759619 11:64808488-64808510 AAGAGTGCAGAGATAAATGAGGG - Intronic
1084046421 11:66570831-66570853 CAGAGGGAAGAGCATAATCAAGG - Intergenic
1084428244 11:69097267-69097289 CAGAGTGGAGTGAAGAGTGAGGG + Intergenic
1084563598 11:69917577-69917599 GAGAGAGAAGAGAAGAGAGAAGG - Intergenic
1084776640 11:71381026-71381048 CACAGTGAAGGGAAGAGGGAGGG - Intergenic
1085229810 11:74956488-74956510 CAAAGCAAAGAGAAGAATCAAGG - Intronic
1085404249 11:76252504-76252526 CAGAGTGAATCAATGAATGAGGG + Intergenic
1085478395 11:76802684-76802706 CAAAGTGAAGTGATGAATGGAGG + Intergenic
1086344512 11:85882567-85882589 CTGAGTGAAGAGAAGGCAGAGGG + Exonic
1086446251 11:86874101-86874123 CTTTGTGAAGAGAAGAATAAAGG + Intronic
1086753078 11:90523858-90523880 CAAAGAGAATAGAAGGATGATGG - Intergenic
1086788173 11:90998880-90998902 CAGAAGGAAGAGAAAAATGCAGG + Intergenic
1087087138 11:94231278-94231300 CCGAATGAAGAGAAAAAGGAAGG + Intergenic
1087524251 11:99287991-99288013 CAAAGTGAAGAGGAGGATAAGGG - Intronic
1087687272 11:101279165-101279187 GAGAGTGAAGAAGACAATGAGGG + Intergenic
1088034811 11:105298544-105298566 CTAAGGGAAGACAAGAATGAAGG + Intergenic
1088123100 11:106393090-106393112 CATAGGGAAGAGAGAAATGAAGG + Intergenic
1088535939 11:110861367-110861389 AGGAGGGAAAAGAAGAATGATGG - Intergenic
1088732063 11:112692394-112692416 GAGAGGCAAGAGAAGACTGAAGG - Intergenic
1088936237 11:114402998-114403020 AAGAGATAAGAGAATAATGAAGG - Intronic
1088968310 11:114747990-114748012 GAAAGTGGAGAGTAGAATGATGG - Intergenic
1088981652 11:114870060-114870082 CAGAGGGGAAACAAGAATGAAGG + Intergenic
1089340383 11:117753338-117753360 CAAAGGGAGGAGAAGAATGCGGG - Intronic
1089905553 11:122034172-122034194 GAGAGAGAAGAGAAGAGAGAAGG - Intergenic
1090127189 11:124099306-124099328 AGGAGAGAAGGGAAGAATGATGG - Intergenic
1090201019 11:124856346-124856368 CAGACTGAAGAGAAACCTGAAGG - Intergenic
1090840221 11:130481034-130481056 CAGAGGGATGAGATGACTGATGG + Intergenic
1090844475 11:130519351-130519373 AAGAGTGCAGAGAAGGCTGAAGG + Intergenic
1090848493 11:130549919-130549941 CAAAGCCAAGAGAAGAAAGAGGG - Intergenic
1090940874 11:131387338-131387360 CAGAGTGAAGAGGGGAGTGCTGG - Intronic
1091239071 11:134040383-134040405 AAGAGGAAAGATAAGAATGAGGG + Intergenic
1091253557 11:134164302-134164324 CAGAAAGAAGAGATGACTGAGGG + Intronic
1091606773 12:1959281-1959303 CAGAGTGAAGAGATGACCTATGG + Intronic
1091880745 12:3975508-3975530 CAGAGTGAAGTGAAGCACGTTGG - Intergenic
1092173939 12:6390353-6390375 CAGGGAGAAGAGAGGAAGGATGG + Intronic
1093278621 12:17161080-17161102 AAAAGTGAACTGAAGAATGAAGG - Intergenic
1094004311 12:25731174-25731196 CAGAGTACAGAACAGAATGAGGG + Intergenic
1094113111 12:26882349-26882371 CAGGGTGTGGAGAAGAAGGAAGG + Intergenic
1094312569 12:29100641-29100663 CAGAGTGAAGATTAGAACCAGGG + Intergenic
1094486229 12:30927664-30927686 GAGCGTGAAGAAGAGAATGAGGG + Intronic
1094566172 12:31600238-31600260 CAGCGGGAAGAAAAGATTGAAGG - Intergenic
1095204218 12:39420956-39420978 TAAAGTGAAGTGAAAAATGAAGG + Intronic
1095265518 12:40152590-40152612 CAAATTGAAGTGATGAATGAAGG + Intergenic
1095399845 12:41801408-41801430 CAGATGAAAGAGAAGAATGATGG + Intergenic
1095626817 12:44324634-44324656 CAGATTGAAGCCTAGAATGATGG - Intronic
1095842748 12:46712311-46712333 GGAGGTGAAGAGAAGAATGAAGG - Intergenic
1096019197 12:48308004-48308026 TAAAGTGAACAGAAGAAAGATGG + Intergenic
1096077952 12:48816558-48816580 CAGAGATATGAGAAGAAGGAGGG + Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096896958 12:54830665-54830687 CAGAATGAACAGAGGGATGAAGG - Intronic
1097155894 12:57012166-57012188 CAGAGGAAAGAGATGAAAGACGG + Exonic
1097924324 12:65110881-65110903 CAGAGTGATGGAAAGAATGGTGG + Intronic
1098340909 12:69450214-69450236 GAGAGTGAGGATAAGAGTGAGGG + Intergenic
1098769006 12:74528690-74528712 CAGAAAAAAAAGAAGAATGATGG - Intergenic
1099064911 12:77963917-77963939 CAGAAGGAGGAGAAGAAGGAAGG - Intronic
1099306909 12:80968832-80968854 CAGAGTGCAAGGGAGAATGAAGG + Intronic
1099393544 12:82110074-82110096 GAGAGAGGAGAGAAGAAGGAAGG + Intergenic
1099551744 12:84053922-84053944 CAGAGTGAAGAGAAAACCAATGG - Intergenic
1100514156 12:95310191-95310213 CATAGAGAAAAGTAGAATGATGG - Intergenic
1100664829 12:96739634-96739656 ATGAGTGAATAGAAGAATAAAGG - Intronic
1100745149 12:97637422-97637444 AAGAATGAAAAGAAGAAGGAAGG - Intergenic
1100806640 12:98292466-98292488 AAGAGAGAAAAGAAGAATGGAGG + Intergenic
1101445847 12:104736324-104736346 GAGAGAGAAGAGAAGAGAGAAGG + Intronic
1101545772 12:105711247-105711269 CAGACTGGAGTGAGGAATGATGG + Intergenic
1102045470 12:109827386-109827408 TAGAGTGAAGGGATGAATGAAGG - Intronic
1103861006 12:124013949-124013971 TTGAATGAAGAAAAGAATGATGG - Exonic
1103971677 12:124676359-124676381 GAGAGTGAAGGAAAGAAGGAGGG + Intergenic
1104235825 12:126935681-126935703 CACAGTGCAGAGAAGAAGAAAGG + Intergenic
1104325708 12:127795118-127795140 AAGAGTGAAGAGAAAAAAGCAGG - Intergenic
1104515412 12:129420709-129420731 CAGAGTGAAGCAAAAAATGAAGG - Intronic
1104540121 12:129656237-129656259 GAGAAGGAAGAAAAGAATGAAGG + Intronic
1104547734 12:129727333-129727355 CAAGGTGGAGAGAAAAATGAGGG + Intronic
1104710863 12:130984881-130984903 GAGAGAGAAGAGAAGAAAGAAGG - Intronic
1105255423 13:18741274-18741296 CAGAGGGAAAAGCAGAATTAAGG + Intergenic
1105299841 13:19123302-19123324 CAGAGAGAAGAGAAAGAGGAAGG - Intergenic
1105427988 13:20312313-20312335 CAGAATGAAGAGATGCATGTGGG + Intergenic
1105819454 13:24066694-24066716 AAGAGTGAGGAGGGGAATGAAGG - Intronic
1105878964 13:24586756-24586778 CAGGAACAAGAGAAGAATGATGG + Intergenic
1105920874 13:24962294-24962316 CAGGAACAAGAGAAGAATGATGG - Intergenic
1106482478 13:30147351-30147373 GAGTTTGAAGAGAAGAAAGAGGG - Intergenic
1106571024 13:30927981-30928003 AAGAGTTTAGAGAAGAATTAGGG + Intergenic
1106634550 13:31513622-31513644 CTGAGAGAAGAGACGAATGCAGG + Intergenic
1106712929 13:32357978-32358000 GACAGTTAAGAGAAGAAAGAGGG - Intronic
1107135917 13:36944046-36944068 CAATGTGAAGACAAGAATGAAGG - Intergenic
1107387796 13:39931396-39931418 AAGTGAGAAGAGAAGAAGGAAGG + Intergenic
1107571443 13:41663309-41663331 CAGATGGAAAAGAGGAATGAGGG - Intronic
1108324965 13:49321056-49321078 CAGAGTGATGGTAAGAATGGTGG - Intronic
1108515361 13:51196741-51196763 AACATTGAAGAGAATAATGATGG + Intergenic
1108863718 13:54896016-54896038 CTGAGTGAAGAGGAGAGTGACGG - Intergenic
1108893825 13:55297527-55297549 ATGAGTGAAAAGAAAAATGATGG - Intergenic
1109371912 13:61433141-61433163 AAGAATGAAGAAAAAAATGAAGG - Intergenic
1109575266 13:64248528-64248550 CAGAATGAACAAAGGAATGAAGG - Intergenic
1109653581 13:65360783-65360805 CAGAGTGAAGAGACAACTTATGG + Intergenic
1110149310 13:72230259-72230281 CACTGTGAAGAGATGAAAGAGGG + Intergenic
1110369783 13:74727173-74727195 AAGAGTGAAGGAAAGAAGGAAGG + Intergenic
1111663973 13:91244297-91244319 CAGAGGGCAGAGAACATTGAGGG + Intergenic
1111796441 13:92926720-92926742 CAGACTGAAAACAAAAATGAGGG + Intergenic
1111797048 13:92935105-92935127 CACAGTGTAGAGAAGTGTGAAGG + Intergenic
1112142982 13:96666391-96666413 CAAAGGGAAGAGAATAATAAAGG - Intronic
1112218194 13:97458195-97458217 CTGTGTGAAAAGATGAATGAGGG + Intronic
1113070199 13:106412783-106412805 AGGAATGAAGAGAAGAATGAGGG - Intergenic
1113278978 13:108767658-108767680 AAGAGTGAAGGGAAGAAGGCAGG + Intronic
1113282313 13:108802271-108802293 AAAAGTAGAGAGAAGAATGATGG - Intronic
1113663049 13:112120145-112120167 AAGAAGGAAGAGAGGAATGAGGG + Intergenic
1114192074 14:20447326-20447348 ATGAGGGCAGAGAAGAATGAAGG - Intronic
1114220176 14:20689341-20689363 CAGGTTGAAGGGAAGAAGGAAGG + Intronic
1114281317 14:21194837-21194859 GAGAAAGAAGAGAAGAAGGAAGG - Intergenic
1114404226 14:22440136-22440158 TAGGGTCAAGAGAAGAGTGAAGG - Intergenic
1114422807 14:22598590-22598612 CAGAGGCCAGAGGAGAATGAGGG - Intronic
1114503243 14:23187723-23187745 CATAGTTACGAGAAGAAGGATGG - Intronic
1114989488 14:28269720-28269742 CTAAGTGAAGAGAAGAAAGCAGG + Intergenic
1115170992 14:30506703-30506725 CAAAAAGAAGAAAAGAATGAAGG - Intergenic
1115762536 14:36589874-36589896 CAGGGTGAAGGGAAGGAGGAAGG + Intergenic
1115937355 14:38567993-38568015 TAGAGAGAAGAGGAGATTGATGG - Intergenic
1116211091 14:41945709-41945731 CAGAAGGAAGAGGAGAAGGAAGG - Intergenic
1116333653 14:43628731-43628753 GAAAATGAAGAGTAGAATGATGG + Intergenic
1116475283 14:45331933-45331955 CGGTGTAAAGAAAAGAATGAGGG - Intergenic
1116742312 14:48772284-48772306 CAGCATGAAGAGAAGAAACAAGG + Intergenic
1116842022 14:49828067-49828089 CTGAGTGAACAGAAAAATGAAGG + Intronic
1117282075 14:54251362-54251384 CAGAGAGAAGAAAGGGATGAGGG - Intergenic
1117441966 14:55768459-55768481 TTGAATGAAGAGAAGAATGGTGG + Intergenic
1117487574 14:56213589-56213611 CATTGTAAAGAGAAGAATGGTGG + Intronic
1117558718 14:56912876-56912898 CAGAGTCAGGGGAAGGATGAGGG + Intergenic
1117622265 14:57599538-57599560 CAGAGTGATTAGAAGAATCTGGG + Intronic
1117765334 14:59076115-59076137 AAGAGTCAAGTGAAGAATGCTGG + Intergenic
1118184546 14:63524826-63524848 AGCAGAGAAGAGAAGAATGAGGG - Intronic
1118348073 14:64954230-64954252 AAGAGTGAAGAGAAGGAGGGAGG + Intronic
1118595677 14:67433335-67433357 CAGAGAGAAGAGAAAAGGGAGGG + Intergenic
1119115887 14:72021132-72021154 AAAAGTGAAGAGAAGGATCAGGG - Intronic
1119128860 14:72153477-72153499 CTCACTGATGAGAAGAATGAGGG - Intronic
1119463832 14:74836522-74836544 GAAAGTGAAAAGAAGAAGGAAGG - Intronic
1119552667 14:75526224-75526246 CAGAGTGAAGAGAGGTAAGGTGG - Intronic
1119932053 14:78556994-78557016 GAGAGGGAAGAGAAGAGAGAAGG - Intronic
1119936064 14:78593608-78593630 AAGAGTGAAGACAAGTATTAAGG - Intronic
1120251642 14:82066275-82066297 CAGAGTGAAAGAAAGAAAGAAGG - Intergenic
1120551271 14:85876017-85876039 CTAAGTGAAACGAAGAATGAAGG + Intergenic
1120696522 14:87650906-87650928 CAGAATGAAGGGAAGAAGAAGGG - Intergenic
1120871383 14:89340082-89340104 GAGAGGAAAGAGAAGAAGGAAGG + Intronic
1121760006 14:96436772-96436794 CAGAGAGAAGGGAAGGAGGAGGG - Intronic
1123736381 15:23188208-23188230 GAGAGGGAAGAGAAAAAGGAAGG - Intergenic
1123827219 15:24094106-24094128 GAGAATGAAGAGGAGAAAGAAGG + Intergenic
1123960575 15:25395413-25395435 CAGAGTAAACAGAAGTATAATGG + Intronic
1124287087 15:28411185-28411207 GAGAGGGAAGAGAAAAAGGAAGG - Intergenic
1124295614 15:28500444-28500466 GAGAGGGAAGAGAAAAAGGAAGG + Intergenic
1125073428 15:35583990-35584012 AAGAAAGCAGAGAAGAATGATGG - Intergenic
1125121233 15:36161147-36161169 AAGACTGAAGGGAAGAAGGAAGG + Intergenic
1125293857 15:38180406-38180428 CAGAGTGAAGAGACCATTTATGG + Intergenic
1125439657 15:39688461-39688483 TAAAGTGAAAAGAAGAATGTTGG + Intronic
1125751250 15:42030612-42030634 CAAAGTGAAGAAATGAATGAAGG - Intronic
1125753514 15:42046491-42046513 CCGAATGATGAGAAGATTGATGG - Intronic
1125786263 15:42320994-42321016 CTGAGTAAAGAGAAGAAAAAAGG - Intronic
1126558834 15:50021262-50021284 GAGAGACAAGAGCAGAATGACGG - Intronic
1126890952 15:53203675-53203697 CAGGGTGAGGAGAAGAGTGAGGG - Intergenic
1127548631 15:60014933-60014955 CAGACAGAAGAGAATAAAGAAGG + Intronic
1127687925 15:61366550-61366572 CAGGGTGAAGACTAGGATGAGGG + Intergenic
1127764739 15:62174014-62174036 GGGAGTGAAGAGAAGAAAGCAGG + Intergenic
1128349271 15:66878180-66878202 CAGAGAGAAGAGGAGAAGGAGGG + Intergenic
1129138272 15:73573747-73573769 CGGAGTGAGAACAAGAATGAAGG - Exonic
1129163992 15:73765110-73765132 CAGAGGGAAGTGAAGAATCTGGG - Intergenic
1129847176 15:78773276-78773298 CAGAGTCAGGAGAAGAAAGCTGG + Intronic
1130407702 15:83616799-83616821 GAGAAGGAAGAAAAGAATGAAGG + Intronic
1130683844 15:86020053-86020075 TTGACTGAAGGGAAGAATGAAGG + Intergenic
1130773017 15:86944068-86944090 AAGAGTCAGGTGAAGAATGAAGG + Intronic
1131779791 15:95843831-95843853 CAGGGTGAAGGGAAGATGGATGG - Intergenic
1132157714 15:99508117-99508139 CAAAGTACAGAGAAGATTGATGG - Intergenic
1132340955 15:101078462-101078484 CAGGGTGCAGAGAGGAAGGAAGG - Intergenic
1133019514 16:2960992-2961014 CAGAGAGATGAGAAAAAGGAAGG + Intergenic
1133534781 16:6691353-6691375 CAGAGAAGAGTGAAGAATGATGG - Intronic
1134301669 16:12997114-12997136 CTGAATGAAAAGAAGCATGAGGG - Intronic
1134569381 16:15278459-15278481 CAGAGAGAAGAGGAAAATGGAGG - Intergenic
1134692038 16:16197493-16197515 CAGAGGGAAGAGAGGGAGGACGG + Intronic
1134745965 16:16588590-16588612 TAGACTGAAGAGCAGAAAGAGGG - Intergenic
1134934442 16:18234387-18234409 CAGAGAGAAGAGGAAAATGGAGG - Intergenic
1134999512 16:18765151-18765173 TAGACTGAAGAGCAGAAAGAGGG + Intergenic
1137451020 16:48573922-48573944 CAAAGTGAAGGTAAGGATGAAGG - Intronic
1137746863 16:50828591-50828613 GAAAGAGAAGAGAAGAAGGAAGG - Intergenic
1137886203 16:52106493-52106515 TAGGGAGAAGAGAAAAATGAAGG + Intergenic
1138130636 16:54476763-54476785 GAGACTGAATAGAGGAATGATGG + Intergenic
1138470672 16:57233343-57233365 CAGAGATGAGAGAAGACTGAGGG - Intronic
1139020829 16:62746939-62746961 CAGAGAGCAGAGAAGATTCATGG + Intergenic
1139266951 16:65648794-65648816 TAGAGTGATGAGCAGAGTGATGG - Intergenic
1139314251 16:66054941-66054963 CTGAGTGCAGTGAAGAATCAAGG + Intergenic
1139592123 16:67938997-67939019 CAGAGTGACAAGAAGAGTAATGG - Intergenic
1139727579 16:68913866-68913888 CAAAGGGAAGAAACGAATGAAGG - Intronic
1140130799 16:72159101-72159123 CAAAGAGAAGCAAAGAATGAAGG - Intronic
1141031964 16:80596923-80596945 ACGAATGAACAGAAGAATGACGG + Intergenic
1141365129 16:83435504-83435526 CAGAGTGAAGAGAGGCAGCAGGG - Intronic
1141645531 16:85365382-85365404 CAGGGAAAAGAGAAGAGTGAAGG - Intergenic
1141754916 16:85984419-85984441 GTAAGTGAAGAGAAGAATGAGGG - Intergenic
1143011224 17:3867270-3867292 CAGAGGGAAGCGAAGTCTGAAGG + Intronic
1143109449 17:4545117-4545139 GAGAGTGAAGAGGAGAGCGAGGG - Exonic
1143580512 17:7822973-7822995 GAGAGTGAAGAGATGAATACAGG - Intronic
1143714188 17:8755408-8755430 CAGAGTAAAGAGGAGAAGTAGGG + Intronic
1144023211 17:11255309-11255331 AAGAAGGAAGAGAAAAATGAAGG + Intronic
1144122941 17:12174220-12174242 GAGCGTGAAGAGAAGAAGTAGGG + Intergenic
1145179253 17:20731049-20731071 CAGAATGAAGAAAAAAATGCAGG - Intergenic
1146061233 17:29608416-29608438 CAGAGTGAAGAGAATAATAATGG - Intronic
1146435317 17:32840621-32840643 AAAAGAGTAGAGAAGAATGAGGG - Intronic
1146961263 17:36982031-36982053 CAGAGAGAAAAGCAGAATGGTGG - Intronic
1147510404 17:41064204-41064226 AAGAGTGAAGAGGAAGATGATGG - Intergenic
1147610209 17:41797543-41797565 CAGAAGGAAGAAATGAATGAAGG - Intergenic
1147679832 17:42234932-42234954 AAGAATGAAGAGAAGAATCTAGG + Intronic
1147788067 17:42994557-42994579 CAAAGTGAGGGGAGGAATGAGGG - Intergenic
1148744529 17:49911007-49911029 CACAGTGAAGAGTAGAAGGAGGG - Intergenic
1148984673 17:51611291-51611313 AAGAATGAAGAAAAGAAGGAAGG + Intergenic
1148993848 17:51690398-51690420 AGAAGTGAAGAGAAGAATGTTGG - Intronic
1149023060 17:51992324-51992346 AAGAGTGAGGATAACAATGATGG - Intronic
1149347141 17:55750779-55750801 CAGAGGGAAGGGAAAAAGGAAGG - Intergenic
1149838912 17:59940682-59940704 CAGAATGAAGAAAAAAATGTAGG - Intronic
1150024896 17:61663898-61663920 CAGACTTCAGTGAAGAATGAAGG - Intergenic
1152913031 17:83016450-83016472 CAGAGAGAAGAGAATAAAGGAGG + Intronic
1153185801 18:2484903-2484925 CAGATTGAAGACAACCATGATGG - Intergenic
1153618423 18:6954489-6954511 CAGAGTGGAGACAAGAAGAAAGG + Intronic
1154106215 18:11525721-11525743 CAGAGTGCAGAGAGTAGTGATGG - Intergenic
1154305483 18:13227722-13227744 GAGAGTGAAGTGCAGAGTGAAGG + Intronic
1154435594 18:14339330-14339352 CAGAGGGAAGAGCAGAATTAAGG - Intergenic
1155231665 18:23780315-23780337 CAGGGTGAAGGAAAGAAGGAAGG + Intronic
1155839184 18:30626488-30626510 CATGGTGAAGAACAGAATGAAGG + Intergenic
1155872720 18:31047186-31047208 CTGAGTAAAAAGAAGACTGATGG - Intergenic
1155929700 18:31693644-31693666 CAAAGTGAAGACAAAAAAGAAGG + Intergenic
1156014923 18:32536752-32536774 AAGATTGAAGGGAAGAAAGAAGG - Intergenic
1156597611 18:38565705-38565727 GAGAGTGAAGGAAAGAAAGAGGG - Intergenic
1157133605 18:45032513-45032535 ATGAGTGAAGAGATGAATGAAGG - Intronic
1157507301 18:48237318-48237340 CATTGTGAGGAGAAGAATGGAGG + Intronic
1158179730 18:54700525-54700547 CAGAGTGAGGAGGAGACTGACGG + Intergenic
1158750967 18:60260363-60260385 CAAAGTAGAGAGTAGAATGATGG - Intergenic
1158891969 18:61880850-61880872 GTGAGTAAAGAGAAGAATAAGGG - Intronic
1158982093 18:62773055-62773077 CAAAGGGAAGAGATGAATGTGGG + Intronic
1159753462 18:72332642-72332664 CAGATTGCAAAGTAGAATGAGGG - Intergenic
1159791457 18:72784890-72784912 CACAGTGAACAAAAGAATGAGGG + Intronic
1159965600 18:74592526-74592548 CAGAGTGATGAGAAAAATCTAGG + Intergenic
1160821128 19:1058693-1058715 TAGTGTGAAGAGAAGGAAGAGGG - Exonic
1161286451 19:3471004-3471026 CAGAGTGAGGAGAGGGATGGAGG + Intergenic
1162329711 19:10020397-10020419 CCTAATGAAGAGAAAAATGAAGG + Intronic
1162994978 19:14328909-14328931 CAGAGTGCTGACAAGAAGGAGGG + Intergenic
1164859344 19:31550450-31550472 CAGAGTGAAGAGAGTGAAGATGG + Intergenic
1165962546 19:39547502-39547524 CAAGGGGAAGAGAAGAAGGATGG - Intergenic
1166171689 19:41032158-41032180 CAGAGTGATGACAAGGATAAAGG + Intergenic
1166177330 19:41083683-41083705 CAGAGTGATGACAAGGATTAGGG - Intergenic
1166385446 19:42378093-42378115 CTGAGTGAAGAGATGTCTGAAGG - Intronic
1167806214 19:51787698-51787720 CAGAATGAAGACGAGAAGGATGG + Intronic
1167968881 19:53173352-53173374 AAGAGTGAAAAAAAAAATGATGG - Intronic
1168579528 19:57543071-57543093 CAGAGTGATCAGAAGAGTGTAGG - Exonic
925019612 2:558191-558213 CCGTGTGAAGAGCAGACTGAGGG - Intergenic
925055428 2:853525-853547 GAGAGAGAAGAGAAGGGTGAAGG - Intergenic
925545499 2:5011402-5011424 CAAAGTGAGTAGAAGAAGGAGGG - Intergenic
925684447 2:6457066-6457088 CAGAGGCAAGAGAAGAATCTGGG + Intergenic
925776858 2:7344234-7344256 CAGAGAGATGAGGAGAATCAGGG + Intergenic
925777604 2:7350033-7350055 CAGAGAGATGAGGAGAATCAGGG - Intergenic
925965898 2:9065665-9065687 CAGAGTTGAGGGAAGAATGGTGG - Intergenic
926161894 2:10495134-10495156 CAGAAGGAAGAAAAGAAGGAAGG - Intergenic
926620412 2:15041968-15041990 CAAAGTGAAGTGAGAAATGAAGG + Intergenic
926805895 2:16710725-16710747 AAGAGTAGAAAGAAGAATGATGG + Intergenic
927291885 2:21412762-21412784 CAGAGTAAAGAAAAGTATCATGG + Intergenic
927292923 2:21422282-21422304 CAGGGAGAGGAGAAGAAGGAGGG + Intergenic
927685916 2:25170225-25170247 GAGAGAGAAGAAAAGAAAGAAGG - Intergenic
928633978 2:33223845-33223867 CAGACTGAAGAGAAATATTATGG + Intronic
928744324 2:34393947-34393969 GAGAGTGAAGTGATGAAAGAAGG + Intergenic
929271487 2:39977126-39977148 GAGAGTGAAGAGGAGACTGGTGG + Intergenic
929292487 2:40209416-40209438 GAGAGTTAAGAGTAGAGTGAGGG + Intronic
929404012 2:41620236-41620258 CAGAAGGCAGAGAAGAATGAAGG + Intergenic
929467060 2:42154522-42154544 GAGAATGAAGAGAAGAGTTACGG + Intergenic
929980174 2:46670933-46670955 CCAAATGAAGAGGAGAATGAGGG + Intergenic
930576033 2:53149879-53149901 CAGAATGATGAGATGAATTAAGG + Intergenic
930590572 2:53321973-53321995 CAGAGTAAAGAGAAGAAGTGTGG - Intergenic
931217925 2:60263688-60263710 CAAAGTGGAGAGAAGGGTGAGGG - Intergenic
931296625 2:60933352-60933374 CAGAGTGAAGAGACAACTTATGG - Intergenic
931646951 2:64432395-64432417 CTTAGTGAAAAGCAGAATGAAGG - Intergenic
931809190 2:65837981-65838003 AATAGTGAACAGTAGAATGAAGG + Intergenic
931826330 2:66004291-66004313 GAGAGGGAAGAGAGGAAGGAAGG - Intergenic
932374603 2:71224680-71224702 CAGGGTGCAGAGAAGCACGATGG - Intronic
932502701 2:72197979-72198001 CAGAGCAAAGAGGAGAATGTTGG + Intronic
932751039 2:74371864-74371886 CAGTGAGAAAAGAAGAATGAAGG + Intronic
933012179 2:77080283-77080305 GAGGCTGAAGAGAAGAATAAAGG - Intronic
933266489 2:80186147-80186169 CAGAGTGAAGAAGATAATGATGG - Intronic
933279710 2:80319663-80319685 CAGAGTGAAAAGCAGAATTGTGG - Intronic
934019677 2:87933888-87933910 CAGAATGTGGAGAGGAATGAAGG - Intergenic
934189306 2:89771605-89771627 CAGAGTGAAAGGGATAATGAAGG + Intergenic
934957993 2:98640758-98640780 CATAGTTAAGGGAAGAGTGAAGG + Intronic
935402141 2:102671200-102671222 CAGTGAGAAGAGAAGAAACAAGG - Intronic
936062126 2:109301797-109301819 CAGAATGAAGACAAGAAGGATGG - Intronic
936702730 2:115033337-115033359 GAGAGTGGAGAGAACAATTATGG - Intronic
937554997 2:123143165-123143187 CAGTGGCAAGAGAAAAATGACGG - Intergenic
937878516 2:126846981-126847003 CAGAAGGAAGAGAACAAAGAGGG + Intergenic
938287984 2:130134574-130134596 CAGAGAGAAGAGAAAGAGGAAGG - Intergenic
938427604 2:131204303-131204325 CAGAGAGAAGAGAAAGAGGAAGG + Intronic
938468541 2:131538325-131538347 CAGAGAGAAGAGAAAGAGGAAGG + Intergenic
938507046 2:131896945-131896967 CAGAGTGAAGAGAAAACCTACGG + Intergenic
938674116 2:133613724-133613746 AAGAGGGAAGAGAATAAAGAGGG - Intergenic
939011838 2:136855774-136855796 GAGTGATAAGAGAAGAATGAGGG - Intronic
939435954 2:142178016-142178038 GAGAGAGAAGTGCAGAATGAGGG - Intergenic
939455204 2:142425396-142425418 CAGAGTAAGGTGAAGAATGATGG - Intergenic
939633138 2:144549848-144549870 CCCAGTGAAGACAAGAATGAAGG - Intergenic
939790162 2:146562375-146562397 GAGAGAGAAGAGAAGAAGAAAGG + Intergenic
940381684 2:153022023-153022045 CACAGTGTAGAGAAGATTTAAGG - Intergenic
940488322 2:154325008-154325030 CAGAGCTCAGGGAAGAATGAAGG - Intronic
940495328 2:154420424-154420446 CAAGGTGGAGAAAAGAATGAGGG - Intronic
940497470 2:154451377-154451399 TAGAGTGAAGAGAAAAGGGATGG - Exonic
940562190 2:155312888-155312910 CAGAGTGAAGAAAATAATTTGGG - Intergenic
940865634 2:158815158-158815180 CCCAGTGAAGAGAAGGCTGAGGG - Intronic
941071100 2:160955524-160955546 TTTAATGAAGAGAAGAATGAAGG + Intergenic
941180682 2:162255406-162255428 AAGAGTTAAGAGAAAAATAAGGG + Intergenic
941545910 2:166851215-166851237 CAGAGTGAAGAGACTACTTATGG + Intergenic
942193619 2:173495483-173495505 TAGAGTGTAGCGAAGAATGAAGG + Intergenic
942367311 2:175241191-175241213 CAGAGGCAAGAACAGAATGAGGG - Intergenic
942911617 2:181251274-181251296 CTGAATGAAGAGAGGAATGCAGG + Intergenic
942914726 2:181291389-181291411 CAAAGTGGAGAGAAGAGGGACGG - Intergenic
943423122 2:187695056-187695078 CAGAGTGAAGAGAAAACATATGG - Intergenic
943459801 2:188158304-188158326 CAGAGTAATGATTAGAATGAAGG - Intergenic
944094058 2:195946726-195946748 CCGGGTGAAGAGAAGGAGGAAGG - Intronic
945650023 2:212545741-212545763 CAGAGAGAAGTGCAGAGTGAAGG + Intergenic
945853163 2:215034407-215034429 CAGAGTGTGGAGAGGAATGGGGG + Intronic
946144427 2:217718339-217718361 CAGAGAGAGGAGAAGAAGGGAGG - Intronic
946394471 2:219436195-219436217 CAGTGTGAAGAAAAGGCTGAGGG + Intronic
946549910 2:220789949-220789971 CAGAGTGAAGAGAAGAATTTTGG - Intergenic
946918660 2:224554071-224554093 AAGAGTGAGGAGAAGAGAGAAGG - Intronic
947133177 2:226950916-226950938 CAAAGTGAAGAGACAACTGATGG - Intronic
947375371 2:229489895-229489917 CAGAGAGAAAAGCAGCATGAGGG + Intronic
947435586 2:230069300-230069322 CAGGGTGGAAACAAGAATGAGGG - Intergenic
947812983 2:233015823-233015845 GAGAGTGAGCAGAAGGATGAGGG - Exonic
947843677 2:233226662-233226684 CAGAGTTAAGAGAAGTAGCAGGG + Intronic
948487892 2:238292362-238292384 CAGGGTGAGGCGAAGAAAGATGG - Intergenic
948732171 2:239973159-239973181 CAAAGTGGAGAGAACACTGAAGG + Intronic
948882378 2:240866478-240866500 CATAGTGAAGAGAATGATCAAGG - Intergenic
1169564042 20:6833354-6833376 CAGAGTAAAAAGAACCATGAAGG + Intergenic
1169752146 20:9005258-9005280 CAGTGACAAGAGGAGAATGAGGG + Intergenic
1170160965 20:13310619-13310641 CAGAGTAAAGAGAAAAATTATGG + Intergenic
1170408947 20:16067723-16067745 CAGAGTGAAAAGAAGACCCAGGG - Intergenic
1171880231 20:30613228-30613250 CAGAGGGAAGAGCAAAATAAAGG + Intergenic
1172334010 20:34098999-34099021 AAGAATAAAGAGATGAATGAGGG - Intronic
1173185422 20:40836590-40836612 CAGAGTGTAGAGGAGGATAAAGG - Intergenic
1173575025 20:44107352-44107374 CAGGGAGAAGAGAAGGATGTGGG - Intergenic
1173623681 20:44455812-44455834 ATGAGTGAAGAGAAGAAGGGAGG + Intronic
1174265810 20:49331094-49331116 CAGAGAGATGAGTAGAAAGATGG - Intergenic
1175380741 20:58561194-58561216 CATAGTGAAGAGAGGAATTTAGG + Intergenic
1175757105 20:61536809-61536831 CACAGTGACGAGAGGAAGGAAGG + Intronic
1176358916 21:5976185-5976207 CAGAATGAAGGGAAGAATAAAGG - Intergenic
1176786586 21:13263352-13263374 CAGAGTGAAGAGAAAACCTATGG - Intergenic
1176841438 21:13846303-13846325 CAGAGGGAAGAGCAGAATTAAGG + Intergenic
1176920605 21:14683603-14683625 AAGAGAGGAGAGAAGAAGGAAGG + Intergenic
1177436257 21:21057253-21057275 AAGAGTGTTGAGAAGAAGGAGGG + Intronic
1177985187 21:27965447-27965469 CAGAGTGAAGAGAAAACCTATGG - Intergenic
1178097397 21:29231096-29231118 CACAGTTAAGATGAGAATGAGGG - Intronic
1178126334 21:29519450-29519472 GAGAAAGAAGAGAAGAATGATGG - Intronic
1178144945 21:29728441-29728463 CTCAGTGAAGAGATGAGTGAAGG + Intronic
1178389298 21:32185324-32185346 AAGAGGGAAGAGAAAAATGCTGG - Intergenic
1178766120 21:35452461-35452483 CACATGGCAGAGAAGAATGAAGG - Intronic
1179764602 21:43562365-43562387 CAGAATGAAGGGAAGAATAAAGG + Intronic
1179794921 21:43776905-43776927 CAGAGGGATGAGAAGAAGGCAGG + Intergenic
1180534284 22:16383136-16383158 CAGAGTGAAAGGGATAATGAAGG - Intergenic
1181483774 22:23218095-23218117 CAGAATGAAGAGAACAGTGAGGG - Intronic
1181751697 22:24993359-24993381 TAGAGTGAAGGGAAGTATCATGG - Intronic
1181770126 22:25119181-25119203 CAGGGTGGACACAAGAATGAAGG - Intronic
1181963789 22:26642538-26642560 GAGAGAGAAGAGAAAAATGGAGG + Intergenic
1182015129 22:27032767-27032789 CAGAGGGAAGAGGAGAACCAGGG - Intergenic
1182018860 22:27064032-27064054 CAGGGTGAGAAGAAGAAAGAAGG + Intergenic
1182191171 22:28462324-28462346 CAGAGAGAAAAGAAGCATGATGG - Intronic
1182517534 22:30867508-30867530 CAGAGAGATCAGGAGAATGAGGG - Intronic
1182747134 22:32614668-32614690 CAGAATGAAGTGGAGATTGAAGG - Intronic
1182836499 22:33346243-33346265 GAGAGAGAAGAGAGGAAGGAAGG - Intronic
1183023058 22:35042948-35042970 CAGACTGAAGAGAAAGAAGAAGG + Intergenic
1183042639 22:35193666-35193688 CGGAGGGAAGGGAAGAAGGAAGG + Intergenic
1183759467 22:39802836-39802858 CAGAGTGATGGAAAGAAAGATGG - Intronic
1183866260 22:40706597-40706619 GAGAGGGAAGAGGAGAATGAAGG - Intergenic
1184312148 22:43653082-43653104 AAGAGTGAAGAGAGGCATGTGGG + Intronic
1185214325 22:49589843-49589865 GAGTGGGAAGAGAAGAAGGATGG - Intronic
1185358184 22:50387725-50387747 AAGAGGGAAGAGAGGTATGAGGG + Intronic
1203238079 22_KI270732v1_random:26723-26745 CAGAGTGAAAGGGATAATGAAGG - Intergenic
1203315359 22_KI270737v1_random:2660-2682 CAGAGTGAAAGGGATAATGAAGG + Intergenic
949166311 3:945700-945722 CAGAGCAAAGACAAGAATGCTGG + Intergenic
949656873 3:6231072-6231094 GAGAGGGAAGAAGAGAATGAGGG - Intergenic
950198516 3:11026517-11026539 CAAAGTGTTGAGAAGAATCATGG - Intronic
950283297 3:11725164-11725186 AAGAGGGAAGAGAACAAGGAGGG - Intergenic
950283458 3:11726209-11726231 CGGAGTGAAGAGAAGAAAACAGG - Intergenic
950383593 3:12638037-12638059 CTGAGTAAAGAGAAGAATGATGG - Intronic
951431946 3:22618394-22618416 AAGAGGAAAGAGAAGAAGGAAGG + Intergenic
951477954 3:23128753-23128775 CAGAGTGAAGAGAAAGGGGAAGG - Intergenic
951616258 3:24548612-24548634 CATGGAGAAGAGTAGAATGAGGG - Intergenic
952056834 3:29457340-29457362 CAGTGTGAAGAACAGATTGATGG - Intronic
952253845 3:31678906-31678928 CTGAGTGAAGAATAGACTGAAGG - Intronic
952289433 3:32001063-32001085 CAGAGTTGAGAGATGAGTGAAGG + Intronic
952599229 3:35058762-35058784 AAAAGTGAAGAGATGAATGCTGG + Intergenic
953100760 3:39824293-39824315 CAGAGCAAAGAGAACAATGCTGG - Intronic
953295111 3:41707412-41707434 CAGAGTGAAGAGACAACTTACGG + Intronic
953787284 3:45920713-45920735 CAGAGTAAACAGAGGCATGATGG - Exonic
954241191 3:49294902-49294924 CAGAGTGATGATCTGAATGATGG - Intronic
954948340 3:54446417-54446439 CAGAGGGAAGAAAAGAAGTAAGG + Intronic
955389695 3:58512218-58512240 GAGAAAGAAGAGAAGAATCAAGG - Intronic
955470136 3:59278269-59278291 CAAAGTAAAGAGAGGAATCAAGG - Intergenic
955538500 3:59950123-59950145 CAGAGAGAAGAAGAGAAGGATGG - Intronic
955926826 3:64014870-64014892 CAAAGTGAAGATAAGAAACAAGG + Intronic
956234843 3:67058328-67058350 CATAGTGAAGATTAGCATGAGGG - Intergenic
956248401 3:67210194-67210216 TAGAGTGAAGAGAAGAATTTAGG - Intergenic
956448285 3:69347115-69347137 CAAAATAAAGAGATGAATGAAGG + Intronic
956514292 3:70029369-70029391 CAGAGAGAAGAGAACTTTGAAGG - Intergenic
956530487 3:70212345-70212367 CAGTTTGGGGAGAAGAATGAGGG - Intergenic
956724425 3:72145492-72145514 CAGAAGGAAGAGAAGGAGGAAGG + Intergenic
958158614 3:89787822-89787844 AACAGGGAAGAGAAGAAAGAGGG + Intergenic
958574547 3:95931322-95931344 AATAGTGAAGAGCAAAATGATGG - Intergenic
959907038 3:111721597-111721619 AAAAGTGAAAAGAACAATGATGG + Intronic
960077789 3:113507554-113507576 CAGAGTGCAAGGAAGATTGAGGG - Intronic
960208417 3:114930989-114931011 GAGAGTGGAGAAAAGAACGAAGG + Intronic
960326790 3:116306487-116306509 CGGAGTGAAGAATTGAATGAAGG + Intronic
960828920 3:121823483-121823505 GAGAATGACAAGAAGAATGAAGG + Intronic
961649997 3:128412550-128412572 CAGAGGGAACAGCAGAGTGAAGG + Intergenic
961796289 3:129411362-129411384 CAGAGGGAAGAGATGAAGGAAGG + Intronic
962430673 3:135316379-135316401 GATGGTGAAGAGAAAAATGAAGG + Intergenic
962800142 3:138883247-138883269 AATAGTGAAAAAAAGAATGAGGG - Intergenic
962827818 3:139112808-139112830 CAGAGAGAAGAGTAGAAGGCAGG + Intronic
963005310 3:140721637-140721659 CTGACTGAAGACAAGAATGCTGG - Intergenic
963006011 3:140726780-140726802 GAGAAAGAAGAGAAGAGTGAGGG + Intergenic
963265853 3:143239297-143239319 CAGACTGAAGAAAAGTATGATGG - Intergenic
963404273 3:144843301-144843323 CAGAGAGAAGTGCAGAGTGAAGG + Intergenic
963631327 3:147734054-147734076 CAGAGAGAAGAGAAAAAAGAAGG - Intergenic
963685008 3:148422064-148422086 TAGACTGAAGAGCAGAATCAGGG + Intergenic
964220210 3:154334836-154334858 TAGAATGAAGAAATGAATGAAGG + Intergenic
964242600 3:154614584-154614606 CAGAGGAAAGTGACGAATGATGG - Intergenic
964704909 3:159607753-159607775 CAGAGGGTTGTGAAGAATGAGGG + Intronic
964820003 3:160757815-160757837 CAGAGGGCAGAGAAGAAAGTTGG - Intronic
965154596 3:165032368-165032390 AAAAGTGAAGAAAAAAATGAAGG + Intronic
965306411 3:167069779-167069801 CAGAGTGAAGACTTGTATGATGG + Intergenic
965408161 3:168296372-168296394 CATAGTAGAGAGGAGAATGATGG - Intergenic
965886978 3:173458016-173458038 CAGAGTACAGAGATGAATTAAGG + Intronic
965961746 3:174437551-174437573 GAGAGGGGAGAGAAGAAGGAGGG - Intergenic
966493498 3:180554054-180554076 CAGAGTGCAGAAAATAATCATGG + Intergenic
966844098 3:184113083-184113105 GAGAGTGGAAAGAAGAATGATGG - Intergenic
966956497 3:184885822-184885844 CAGAGGGAGCAGAAGAAGGAGGG - Intronic
969147821 4:5139491-5139513 CAGAAGGAAGTGAAGCATGAAGG + Intronic
969838267 4:9861008-9861030 CAAAATGAGGAGGAGAATGATGG - Intronic
970290496 4:14565913-14565935 GAGAAAGAAGAGAAAAATGAAGG - Intergenic
970293057 4:14597587-14597609 CAGAGCTCAGAGAAGAAAGAAGG - Intergenic
970443414 4:16104633-16104655 AATAGAGAAGAAAAGAATGAAGG + Intergenic
970589015 4:17542834-17542856 TAGAGATAACAGAAGAATGAAGG + Intergenic
971629825 4:28976527-28976549 CAGACTCAAGTGAAGTATGAAGG - Intergenic
971961031 4:33487300-33487322 GAGGGAAAAGAGAAGAATGAGGG + Intergenic
972083832 4:35187640-35187662 CAGAATGGAGGGTAGAATGAGGG + Intergenic
972685388 4:41347822-41347844 CAGAGTGAAGAAGAGAAGGAAGG - Intergenic
972789365 4:42356077-42356099 CAGAGGGAGGAGGAGAGTGAAGG + Intergenic
972873348 4:43327931-43327953 CAGAGGGAAGAGAAAATTCAGGG + Intergenic
973083885 4:46030104-46030126 AAGATTGAAGAGATGAATGGGGG - Intergenic
973150976 4:46887827-46887849 CAGGGTGCAGAGCAGAATGAGGG - Intronic
973259235 4:48144473-48144495 CAGAAGGAAAAGAAGAATGGAGG + Intronic
974475995 4:62381135-62381157 CAGAGTGAAGAGACAACTGTTGG - Intergenic
974572472 4:63670801-63670823 CAAAGTGAAGTGAATAATGTAGG + Intergenic
974878492 4:67725271-67725293 AAGGGTGAAGAGATGAAAGAAGG - Intergenic
974920458 4:68232906-68232928 CAGAGTAAAGAGAATTATCATGG - Intronic
975113424 4:70651820-70651842 CAAAGTGAAGAGGAAAATGTAGG - Intronic
975178817 4:71319746-71319768 AAGAGTGAAGAGAATACTAAAGG - Intronic
975299278 4:72770792-72770814 CATACTGAAAAGAAGACTGATGG - Intergenic
975570269 4:75809718-75809740 CATAGTGAGAAGAAGAATGCTGG - Intronic
976138893 4:81969070-81969092 GAAAGAGAAGAGAAGAAAGAGGG + Intronic
976826686 4:89268398-89268420 CAGAGTGATTAGGAGAATGTTGG + Intronic
977334066 4:95673857-95673879 AAAAGTGAAGAGAATACTGAAGG - Intergenic
977967948 4:103177417-103177439 AAGAGTCAAGAGAAGAATGGTGG - Intronic
978125362 4:105129298-105129320 CAGAGCCAAGAGCAGACTGAAGG - Intergenic
978386506 4:108180785-108180807 AAGAGGGAAGAGAAGGAAGAAGG + Intergenic
979588287 4:122446706-122446728 AAGAATGAAGAGAGGAATAAAGG - Intergenic
980499631 4:133631733-133631755 AAGAGTTACAAGAAGAATGAGGG - Intergenic
980559838 4:134459071-134459093 CACAGAAAGGAGAAGAATGAAGG - Intergenic
980731256 4:136826675-136826697 CAGAGTGCAGAGAGGTAGGAGGG - Intergenic
980795242 4:137674261-137674283 AAGACTGATTAGAAGAATGAAGG - Intergenic
981863579 4:149386252-149386274 CAGTGGAGAGAGAAGAATGAGGG + Intergenic
981944490 4:150325343-150325365 CACAGTGAGGAGAAAAATGATGG - Intronic
982379941 4:154739715-154739737 CAGAGTCAGGAGCAGAATGCAGG - Intronic
983046480 4:162992842-162992864 AAGAATGTAGAGAAGCATGATGG - Intergenic
983812523 4:172081202-172081224 CAGATTGAAGATAAGCATTAAGG - Intronic
983907840 4:173203530-173203552 AAGAGAGAAGAGCAGAATGAAGG - Intronic
984218081 4:176939622-176939644 CAGAGAGAAGAGCAGTATGCTGG - Intergenic
984309422 4:178037974-178037996 CAGAGTGAAGGGAAGCACGATGG + Intergenic
984542694 4:181060358-181060380 CAGAGGGAAGAAAAGGATGGGGG - Intergenic
984903108 4:184602110-184602132 AAGAGTGAAGACAAGATTAAAGG + Intergenic
985088356 4:186338401-186338423 CTGAGTGAAAAGAAGAACGCTGG - Intergenic
985851611 5:2392551-2392573 AAGATGGAAGAGAAGAAAGAAGG - Intergenic
985882297 5:2647517-2647539 CCCACTGAAGAGAAGATTGAAGG - Intergenic
986009667 5:3700806-3700828 GAGAAGGAAGAGAAGAAGGAGGG - Intergenic
986422873 5:7601696-7601718 CAGAGTGAAGAGAAGAATGAAGG - Intronic
986774917 5:11005576-11005598 TAGAGTGGAGATAAGAAAGAAGG + Intronic
987255786 5:16149545-16149567 CAGGGTGAAGTGAAGAATTTGGG - Intronic
987277881 5:16380674-16380696 CATAGTGGAGAGAAGAGAGAAGG - Intergenic
987445380 5:18011264-18011286 TATAGTGAAGAGAAGAAGGGTGG - Intergenic
987983045 5:25113200-25113222 GAGAGTGGAGAGTAGAAGGAGGG + Intergenic
988410829 5:30883863-30883885 CAGCATGAAGTGAAGAAAGAGGG + Intergenic
989290852 5:39763528-39763550 GAGAGTGAAGAGTGGGATGAGGG - Intergenic
989721022 5:44528239-44528261 GAGAGTGAAACTAAGAATGACGG - Intergenic
990231286 5:53715853-53715875 GAGAGTGAACAGAAGCAAGATGG + Intergenic
990476116 5:56163158-56163180 CAGAGTGAGGGCAAGAATGCAGG - Intronic
990533615 5:56698405-56698427 CAGAGTACAGAGAACAATGCTGG - Intergenic
991043467 5:62198436-62198458 AAGAGTGAATAGAAAAATCATGG + Intergenic
993971075 5:94420727-94420749 AAGAGGGAAGAAAAGAAGGAAGG + Intronic
994032512 5:95160654-95160676 CAGAGTGAAGAGACAAACCATGG + Intronic
994037765 5:95222211-95222233 CAGTGTGGAGAGAAGAAGGCAGG - Intronic
994475151 5:100258537-100258559 AAGAATGGAGAGAAGAATGGAGG - Intergenic
994610431 5:102031164-102031186 CACAGAGATGAGAAGAAAGAAGG - Intergenic
995423837 5:111996994-111997016 CACACTGGAGAGAAGAATCAGGG + Intronic
995484442 5:112625888-112625910 GAGAGTGAAGAGATGAATAGAGG - Intergenic
995609196 5:113890928-113890950 CAGGGTGTAGAGAAGGATCAAGG - Intergenic
995721919 5:115144342-115144364 CTGAGGGAAGAGAAGGATGAAGG - Intronic
995737705 5:115320164-115320186 CAGAGGGAAGAGACGAAAGCAGG + Intergenic
996135316 5:119834310-119834332 CAGAGTGGAGAGAAGATGGGAGG - Intergenic
996369834 5:122741475-122741497 TAAGGTAAAGAGAAGAATGAAGG - Intergenic
996538912 5:124608555-124608577 CAGAGTGAAGAGAAGGCAGATGG + Intergenic
996759636 5:126974226-126974248 CAGAATGAAGAAAAGATGGATGG + Intronic
996972811 5:129393573-129393595 AAGAGGGAAGAGAAGAGGGAAGG + Intergenic
998439549 5:142145631-142145653 CAGAGTGAAGAGCAAAAATAGGG + Intronic
999524128 5:152383939-152383961 AAGAAGGAAGAGAAGAAGGAAGG - Intergenic
1000850561 5:166334998-166335020 GAGTATGAAGAGAAGAAAGAAGG + Intergenic
1002047512 5:176550196-176550218 CAGAGTGAGGATAAAAATCAAGG - Intronic
1002690753 5:181048342-181048364 CACAGAGAACAGAAGAATGTCGG + Intronic
1002885716 6:1292164-1292186 CAGAGTTAAGAGCAGAATAGGGG - Intergenic
1003006598 6:2388666-2388688 CAGAGTGAACTAAAGAATAATGG - Intergenic
1003532223 6:6947162-6947184 CATTGTGAAGACAAGGATGAAGG + Intergenic
1003692326 6:8366923-8366945 GAGAGAGAAGAGTAGAATTAAGG + Intergenic
1005023115 6:21436546-21436568 CAGGGAGAAGAGAAGAATTGTGG - Intergenic
1005607997 6:27494995-27495017 AGGGGTGAAGAGAAGAGTGAAGG - Intergenic
1006655375 6:35587843-35587865 CAGAGTCAAGAGAACAATCTGGG + Intronic
1007088562 6:39167646-39167668 CAGCGGGAAGGGAAGAGTGAGGG + Intergenic
1007368597 6:41411817-41411839 GACAGGGAAGAGAAGGATGAGGG - Intergenic
1007960390 6:45953593-45953615 AAGAGTGTTGGGAAGAATGAAGG + Intronic
1008515249 6:52312836-52312858 CATAGTGAAAAAAAGAAAGAAGG + Intergenic
1008673971 6:53799850-53799872 CAAAATGGAGAGAAGAAGGAAGG - Intronic
1009057932 6:58360670-58360692 CAGAGTGAATGGAAGAACCAGGG - Intergenic
1009195927 6:60684364-60684386 GAGAGAGAAGAGAAGAGAGAAGG + Intergenic
1009232897 6:61086421-61086443 CAGAGTGAATGGAAGAACCAGGG + Intergenic
1009286803 6:61828671-61828693 CAAGGGGCAGAGAAGAATGAGGG - Intronic
1009358482 6:62784051-62784073 CAGTTTGAAAAGAAAAATGAAGG - Intergenic
1009435436 6:63612928-63612950 GAGAGTGAAGAGAAAAAGGTGGG - Intergenic
1009580881 6:65532299-65532321 CAGATTGAATAGAAATATGAAGG - Intronic
1009849190 6:69173717-69173739 TAGAGGGAATGGAAGAATGATGG + Intronic
1010897999 6:81389913-81389935 CAGAGTTAAGAGAAAAATTCAGG + Intergenic
1011172602 6:84522500-84522522 CAGAGTAAAGACAAGAAGGGAGG + Intergenic
1011558740 6:88594489-88594511 GAGAGCGCAGAGGAGAATGAGGG - Intergenic
1011577977 6:88825851-88825873 CAGAGTGAGGAGAAGGATAGTGG - Intronic
1011668720 6:89661460-89661482 GACAGTGAAGACAAGAATGGTGG - Exonic
1011712505 6:90069004-90069026 CAGAGGGAAGCAAAGAAGGAAGG - Intronic
1012027897 6:94021005-94021027 CAGAGTGAACAGAAAACTCATGG - Intergenic
1012201488 6:96411674-96411696 GAGAGTGAAGAAGAGAAAGAGGG - Intergenic
1012222836 6:96671292-96671314 CAGAGTGAAGAAAATTATGAGGG + Intergenic
1012394016 6:98774980-98775002 CACAGTGCAGAGAAAAGTGAAGG + Intergenic
1012931957 6:105326785-105326807 CAGAGAAAAGAGAAAAATGGAGG + Intronic
1012962911 6:105641570-105641592 AAGAGTGAACAGAAAAATGATGG - Intergenic
1013373770 6:109494393-109494415 AAAAGTTAAGAGAAGAAAGAAGG + Intronic
1016371772 6:143382098-143382120 CAGAGTGAGGAGAAAATTGTGGG + Intergenic
1016445787 6:144130922-144130944 CAGAGTGAAGCAAAGCAAGAAGG + Intergenic
1016648632 6:146438845-146438867 CAGAGCCCAGGGAAGAATGATGG + Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017194564 6:151685610-151685632 AAGAGTGGGGAGAAGACTGAGGG + Intronic
1018207418 6:161448552-161448574 GAGAAAGAAGAGAAGAAAGACGG - Intronic
1018425334 6:163674882-163674904 CAGAGTGAAGAGGGGGAAGATGG + Intergenic
1019007054 6:168807422-168807444 CAGAAAGAAGAAAAGAATGAAGG - Intergenic
1019096178 6:169581618-169581640 CAGACTGAAAAGATGAATTAGGG + Intronic
1019207465 6:170374684-170374706 CTGAGTGAAGGGAAGAAGAAAGG - Intronic
1019954704 7:4404544-4404566 CAGAGAGGAGAGAGGTATGATGG + Intergenic
1020202779 7:6093267-6093289 GAGAGAGAAGAAAAGAAGGAAGG - Intergenic
1020510527 7:9050783-9050805 CTGGGAGGAGAGAAGAATGAGGG + Intergenic
1021163771 7:17308205-17308227 AAGAGAGAAAAGAAGAAGGATGG - Intronic
1021344160 7:19502947-19502969 TAGAGTGAAGAGAAGAGGAAAGG + Intergenic
1021407107 7:20284645-20284667 AAGAGAGAAGAAAAGAAAGAAGG - Intergenic
1021501539 7:21337152-21337174 CAGAGTGAGGGTAGGAATGAAGG - Intergenic
1021757982 7:23873987-23874009 CAGAATGTAGAAAAGACTGATGG - Intergenic
1021822765 7:24514768-24514790 AAGAATGAAGAAATGAATGAGGG - Intergenic
1022031082 7:26492431-26492453 CAGTGGGAAGGGGAGAATGAGGG + Intergenic
1022219297 7:28296607-28296629 AAGAGAGAAGGGAAGAAGGAAGG - Intergenic
1022451582 7:30520811-30520833 CAGAGTGGAGAGAGGCAGGAAGG + Intronic
1022485795 7:30776709-30776731 GAGAGGGAAGACAAGGATGAAGG - Intronic
1022858420 7:34339932-34339954 AACAGTGAAGAGATGCATGAAGG - Intergenic
1023294718 7:38702650-38702672 CAGAGTGAAGAGAAGCAGTGAGG - Intergenic
1023305325 7:38819814-38819836 GAGTGAGAAGAGAAGACTGATGG - Intronic
1023370375 7:39507042-39507064 GAGAGAGAAGAGAGGAAGGAAGG + Intergenic
1023776800 7:43615775-43615797 CAGAGGGAAGAGAAGTATAGAGG - Intronic
1024121255 7:46243637-46243659 AAGAGAGACGAGTAGAATGAGGG - Intergenic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024435441 7:49348268-49348290 GAGAGTGAAGGGGAGAAGGAGGG - Intergenic
1024794584 7:53005817-53005839 GAGAGTGAAAAGGAGAATTATGG + Intergenic
1024804742 7:53125184-53125206 CAGAGTGAAAGGGATAATGAAGG + Intergenic
1024816254 7:53275361-53275383 AAGGCTGAAGAGAAGAATGTTGG - Intergenic
1026552299 7:71379065-71379087 CAGAGTGAAGAGTGCCATGATGG + Intronic
1026600925 7:71776658-71776680 CTGAGAGCAGAGAAGAAAGATGG + Intergenic
1027542966 7:79491731-79491753 CAGTGTGAAGACAAGGAAGATGG - Intergenic
1028290088 7:89055251-89055273 GAAAGTGAAGACAAGAATGGTGG + Intronic
1028556447 7:92131097-92131119 AAGAGGAAAGTGAAGAATGAAGG + Intronic
1028557758 7:92141457-92141479 CAGAGAGAAAAGAAGAAAGCTGG - Intronic
1028713830 7:93941137-93941159 CAGAGTGAAGAAGGGAAAGAAGG - Intergenic
1028791069 7:94853586-94853608 CAGGGAGAAGAGAAGGATGGGGG - Intergenic
1029055509 7:97736687-97736709 GGGAGTGCAGGGAAGAATGAGGG + Intronic
1029608341 7:101613473-101613495 CACGGTGAAGAGAAGGATTAGGG - Exonic
1029794600 7:102880984-102881006 GAGAGAGTAGAAAAGAATGAGGG + Intronic
1030286685 7:107834075-107834097 AAGAATGAAGAGGAGAATTAAGG + Intergenic
1030582953 7:111383157-111383179 GAGACTGAAGAGAATAAAGAGGG + Intronic
1030616072 7:111739365-111739387 CAGAGTGTGGGGAAGACTGAGGG - Intronic
1031084044 7:117284664-117284686 GAGAGTGAAAAGAAGATAGAGGG - Intronic
1031144624 7:117984219-117984241 AAGAGTTAGGTGAAGAATGAAGG + Intergenic
1031863252 7:127007445-127007467 CAGAGTGATGGGAAGAATCAAGG - Intronic
1031872918 7:127107050-127107072 CAGAAAGGAGAGAAAAATGAAGG + Intronic
1032301788 7:130694439-130694461 CAGAGTGGAGATTAGAATGGGGG - Intergenic
1032484282 7:132272180-132272202 CAGAATGCAGGGAAGACTGAAGG - Intronic
1032503235 7:132415633-132415655 GAGAGTGAGGAGGAGAAAGAGGG - Intronic
1033124745 7:138697810-138697832 AAGAGAGAAGAGAAGGAAGAAGG + Intronic
1033172172 7:139093911-139093933 CAGAGTGATCAGAAGAAAGTCGG - Intronic
1033238319 7:139656084-139656106 AAGAGGAGAGAGAAGAATGATGG - Intronic
1033328095 7:140395905-140395927 CAAAGTGTAAAGAAGAATGTGGG + Intronic
1033529917 7:142251490-142251512 CAGGGTGAAGTGAAGAGAGAAGG + Intergenic
1033585280 7:142770325-142770347 CATAGGGATGAGAAGAAGGAGGG - Intergenic
1033865705 7:145687977-145687999 CAGTGGCAAGAGAAAAATGAAGG + Intergenic
1034754315 7:153600715-153600737 CACAGGGAAGAGAAGGCTGAAGG + Intergenic
1034847523 7:154460373-154460395 CAGAGTGAAGAGACGGAAGTGGG - Intronic
1035167639 7:157000731-157000753 CAGAGGGAAGAGGAAAAGGAAGG + Intronic
1035416105 7:158688468-158688490 GAGAGTGAAGAAATTAATGATGG - Intronic
1035886456 8:3296380-3296402 CTGAGAGCAGAGAAGAATGGGGG + Intronic
1037410271 8:18588547-18588569 AAGAGTGAATAGTAGAATCATGG - Intronic
1037656152 8:20885953-20885975 CAGAGAGAAGAAAAGAAGGATGG + Intergenic
1037805387 8:22055716-22055738 CAGAGAGAAGGGAGGAAGGAAGG - Intronic
1038127493 8:24691000-24691022 AAGATTGAAAAGAAGAATGATGG + Intergenic
1038146112 8:24897634-24897656 CAGATTTCAGACAAGAATGATGG + Intergenic
1038560766 8:28577355-28577377 TAGATTAAAGAGAAAAATGAAGG - Intergenic
1038774609 8:30517351-30517373 CAGAATGAAAAGAAGGATAAGGG - Intronic
1039272765 8:35900825-35900847 CAGACAGAAGAAAAGAAGGAAGG - Intergenic
1040105841 8:43541396-43541418 CAGAGGTAAGAGAAAAATTAGGG - Intergenic
1040702570 8:50085339-50085361 TAGAAGGAAGAGAAGAAAGAAGG - Intronic
1041617521 8:59925271-59925293 GAGAGAGAAGAGGAGAATGAGGG + Intergenic
1041710714 8:60891813-60891835 AAAAGTGACGAGTAGAATGAGGG + Intergenic
1041746155 8:61211340-61211362 GAGGGGGAAGAGAAGAAGGAGGG - Intronic
1041838751 8:62246283-62246305 GAGATTGCAGAGAAAAATGAAGG + Intergenic
1042989439 8:74622101-74622123 CAGAGTGAAGAGATGACCTATGG + Intronic
1043514907 8:80986822-80986844 GAGAGGGATGTGAAGAATGAGGG + Intronic
1043763944 8:84105276-84105298 GAAAGAGAAGATAAGAATGAAGG + Intergenic
1044113736 8:88308151-88308173 CAGGGTGAAGTGAAGAATTGTGG - Intronic
1044297545 8:90546157-90546179 CAGGCTGCAGGGAAGAATGAAGG + Intergenic
1045083998 8:98660804-98660826 GAAAGTGAAGAGAAGAGGGAAGG - Intronic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1046350621 8:113006341-113006363 CAGAGTTAAAAGAAGACTGGTGG + Intronic
1046408367 8:113805060-113805082 CAGAGTGAAGAGAAGACCTAAGG - Intergenic
1046801289 8:118430666-118430688 AAGAGTGAAAAGAATAAAGACGG - Intronic
1047289099 8:123513588-123513610 GAGAGAGAAGAGAACAAAGAGGG - Intronic
1047719423 8:127625772-127625794 CTGAGTGAAGAGATGAATTGTGG - Intergenic
1047762649 8:127965598-127965620 CAGAGTGGAGAGAACAAGGAAGG - Intergenic
1047845451 8:128800769-128800791 AAGAGTAAAGAGAGGAAAGAAGG - Intergenic
1047895469 8:129361679-129361701 CAGAGTTAAGAGAAAAATGTTGG + Intergenic
1047961285 8:130013871-130013893 CAGAATGGGCAGAAGAATGATGG - Intronic
1048630435 8:136236458-136236480 GAGAGTGAAGAGAAAGAGGAGGG - Intergenic
1049012899 8:139899459-139899481 CAACGTGAAGATAAGGATGAAGG - Intronic
1050093857 9:2043420-2043442 CAAAATGAAAAGAAAAATGATGG - Intronic
1050140917 9:2514785-2514807 CAGATTGAATAGAAGAAGGGAGG - Intergenic
1050188183 9:2997203-2997225 CAGAGTTAGGAGAATAAAGAAGG - Intergenic
1050488487 9:6161744-6161766 CATAGTGAAATGATGAATGAAGG - Intergenic
1052018703 9:23499845-23499867 CAGAGTGATGAGATGTAAGAAGG + Intergenic
1052492178 9:29183861-29183883 CAGTGTGAACGGAAGACTGAGGG - Intergenic
1052549439 9:29929272-29929294 CAGAGTAAAGACAAAAGTGAAGG + Intergenic
1053216106 9:36271971-36271993 CAGAGAGAAAAGAACAAGGATGG - Intronic
1053239031 9:36481361-36481383 CAGGTGGAAGAGTAGAATGATGG - Intronic
1053442931 9:38130752-38130774 CAGAGTGAGCAGTGGAATGAAGG + Intergenic
1053516528 9:38735071-38735093 CAGAAGGAAGAAAAGAAGGAAGG - Intergenic
1055132276 9:72789632-72789654 CAGAGTTAGGAGAAGAGTCAGGG + Intronic
1055132399 9:72791215-72791237 CAGAGACAAGAGAATAATGCAGG - Intronic
1055211309 9:73796556-73796578 ATTAGTGAGGAGAAGAATGATGG - Intergenic
1055324753 9:75117868-75117890 GAGGGTCAAGAGGAGAATGAAGG - Intronic
1055513790 9:77018366-77018388 CAGAGAGAAGAGAAGCAAGAAGG + Intergenic
1055989569 9:82091197-82091219 CAGAGTTGAGAAAAGAATGCGGG + Intergenic
1056135396 9:83625057-83625079 CTGAGTGAGGGGAAGCATGATGG + Intronic
1056847374 9:90052421-90052443 AAAAGTGAAGAGAAGAAGGCAGG - Intergenic
1058395391 9:104547376-104547398 CAGAGTGAAGAGACAATTTATGG + Intergenic
1058400540 9:104613163-104613185 CAGAAGGAAGAGAAGGATGGAGG + Intergenic
1058624655 9:106922390-106922412 CAAAGTAAATAGCAGAATGAAGG + Intronic
1058778959 9:108314089-108314111 AAAAGTGGAGAGTAGAATGATGG - Intergenic
1058849638 9:108998359-108998381 AAGAGTTAGGAGAACAATGAAGG - Intronic
1058906122 9:109484028-109484050 CAGAGTGAAGAGGAGGAAGTTGG - Intronic
1058990439 9:110250543-110250565 CAGAGTGTAAAGTAGAATGTAGG + Intronic
1059824198 9:118008940-118008962 CAGAGTTAGGATGAGAATGAAGG + Intergenic
1059979953 9:119760621-119760643 AAGAGTGAAGAGAAGAAATTGGG - Intergenic
1059986150 9:119822663-119822685 CAGTGGCAAGAGAAAAATGAGGG - Intergenic
1060040366 9:120295285-120295307 GAGAGTGAAGAGAAGACATAAGG + Intergenic
1060801122 9:126546390-126546412 GAGAGTGAAGGGAAGATTGAGGG + Intergenic
1061297760 9:129686237-129686259 CAGAGTCAAGACAAGGGTGAGGG + Intronic
1061840876 9:133357944-133357966 CACAGTGAAGAGAGGGATGATGG + Intronic
1062275809 9:135730056-135730078 CACAGTGCAGAGGAGAATGTGGG - Intronic
1062425965 9:136506403-136506425 CAGGGTGAGGAGGAGGATGAAGG + Intronic
1203616248 Un_KI270749v1:68584-68606 CAGAGTGAAAGGGATAATGAAGG - Intergenic
1186183394 X:6994624-6994646 AAGAATGCAGAAAAGAATGAGGG + Intergenic
1186240394 X:7559296-7559318 CAGAGGGAAAAAAAGAAAGAAGG - Intergenic
1186501645 X:10055517-10055539 GAGAGGGGAGAGAAGAAAGAAGG - Intronic
1186838436 X:13460928-13460950 GAGAGGGAAGAAAAGAAGGAAGG + Intergenic
1187328932 X:18317889-18317911 TGGAGGGAAGAGAGGAATGAAGG + Intronic
1188404972 X:29796826-29796848 CAGAGTGAACAGGAAATTGATGG - Intronic
1188425361 X:30040778-30040800 AAGAGAGAAAAGAAGAAGGAAGG - Intergenic
1188836996 X:34970368-34970390 CAGAGTGCAACGAAGACTGAGGG + Intergenic
1188965162 X:36542331-36542353 AAGAAAGAAGAGAAGAAAGAAGG + Intergenic
1189124832 X:38435475-38435497 CAGAGAGAAGGGAGGAAGGAAGG - Intronic
1189376082 X:40467236-40467258 CAGAGGGCAGAGGAGAATGAGGG - Intergenic
1189656260 X:43248077-43248099 CACAAGGAAGAGAAGCATGAAGG + Intergenic
1189905354 X:45753719-45753741 CAAAGTCAAGAGATGAAGGAAGG + Intergenic
1190255511 X:48759497-48759519 CAGAGTGAAACGAATAATGAGGG + Intergenic
1190320040 X:49174703-49174725 CAGATTGCAGAGAGAAATGAGGG - Exonic
1191084749 X:56552958-56552980 CAAAGTGATGAGAATAATTATGG - Intergenic
1191159000 X:57307172-57307194 CAGAGAGAATAGAAAGATGAAGG - Intronic
1192246672 X:69378761-69378783 GAGAGAGAAGAGAAGAGTGAGGG - Intergenic
1192259210 X:69494128-69494150 CAGACTTCAGAGAAGAAAGAGGG + Intergenic
1193586644 X:83329919-83329941 CAGAGTGGAGAGAGGCATAAAGG + Intergenic
1193783136 X:85728078-85728100 GAAAGTGAAGAGAAAAATAAAGG - Intergenic
1194000074 X:88417291-88417313 AAGAGTGAAGGGAGGAAGGAAGG + Intergenic
1194022328 X:88707245-88707267 CAGAGTCAAGAGAAGAAGAAGGG + Intergenic
1194368986 X:93047307-93047329 CAGTGTGAAGAAAAAAATGTGGG + Intergenic
1194728666 X:97428656-97428678 GAGGGTTAAGAGAAGAAGGAGGG - Intronic
1194904006 X:99550960-99550982 CAGAGTGAGAAGGAGCATGACGG - Intergenic
1195322020 X:103728153-103728175 CAGGGTCCAGAGAAGAAGGAAGG + Exonic
1195660683 X:107374939-107374961 CTCAGAGAAGAGAAGAATGGTGG - Intergenic
1195752196 X:108170417-108170439 GAGTGTGAAGAGAAGAATATGGG - Intronic
1196016777 X:110948000-110948022 TAAAGTGAAGTGAAGAATTAAGG + Intronic
1196093828 X:111776878-111776900 CAGAGAGACGATAATAATGATGG - Exonic
1196201294 X:112888586-112888608 CAGATTTAAGAGAATATTGAAGG - Intergenic
1196487086 X:116224660-116224682 CAGAGTGAAGAGAAAACCTATGG + Intergenic
1197140385 X:123111248-123111270 CAGAGAGCAGAGAATAATCACGG + Intergenic
1197181523 X:123542027-123542049 AAGAGAGAAGAAAAGAAAGAGGG - Intergenic
1197279444 X:124518038-124518060 CAGAGTTAAGAGAATTATCAAGG + Intronic
1197391903 X:125877919-125877941 AAAAGTGGAGAGAAAAATGAAGG - Intergenic
1197718935 X:129731565-129731587 CAGAGTAAAGAGAGGAAGGAAGG + Intergenic
1197858408 X:130944015-130944037 CAGGGTGAAAAGAACAATAAAGG - Intergenic
1198217623 X:134570271-134570293 CAGAGGGAAAAGAAGGCTGAGGG + Intronic
1198421675 X:136474701-136474723 GAGAGTGAAGGGAAGTAAGATGG + Intergenic
1198520889 X:137451313-137451335 CAGAGGGAAGAAAGGGATGATGG + Intergenic
1198574406 X:137994225-137994247 TAGAGTGAAGACAAGTCTGAAGG + Intergenic
1198793562 X:140371833-140371855 CAGAGTGAACAGCAAAATCAAGG + Intergenic
1198943958 X:141988819-141988841 CAAAGTGAAGAGAAAACTCATGG - Intergenic
1199124850 X:144105247-144105269 CAGAATGTGGAGAGGAATGAAGG + Intergenic
1199179678 X:144838717-144838739 CAAAGGGAACAGATGAATGAGGG + Intergenic
1200677192 Y:6163641-6163663 CAGTGTGAAGAAAAAAATGTGGG + Intergenic
1200884410 Y:8253687-8253709 CAGAGGGAAGAGAGAAAGGATGG + Intergenic