ID: 986423533

View in Genome Browser
Species Human (GRCh38)
Location 5:7608255-7608277
Sequence CAGGGAAATAACACAGTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 227}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986423527_986423533 1 Left 986423527 5:7608231-7608253 CCTTATCCAAAGATCACCTGTGA 0: 1
1: 0
2: 1
3: 17
4: 125
Right 986423533 5:7608255-7608277 CAGGGAAATAACACAGTTGGAGG 0: 1
1: 0
2: 2
3: 30
4: 227
986423529_986423533 -5 Left 986423529 5:7608237-7608259 CCAAAGATCACCTGTGAGCAGGG 0: 1
1: 0
2: 2
3: 12
4: 178
Right 986423533 5:7608255-7608277 CAGGGAAATAACACAGTTGGAGG 0: 1
1: 0
2: 2
3: 30
4: 227
986423526_986423533 4 Left 986423526 5:7608228-7608250 CCACCTTATCCAAAGATCACCTG 0: 1
1: 0
2: 0
3: 15
4: 150
Right 986423533 5:7608255-7608277 CAGGGAAATAACACAGTTGGAGG 0: 1
1: 0
2: 2
3: 30
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986423533 Original CRISPR CAGGGAAATAACACAGTTGG AGG Intronic
901490244 1:9593003-9593025 CTGGGACAAACCACAGTTGGTGG - Intronic
902654050 1:17855477-17855499 CAGGTCAATAACACAGATGTCGG + Intergenic
903001152 1:20266790-20266812 CAGAGAAAGAACACAGATGGAGG + Intergenic
908986258 1:70026879-70026901 GAGAAGAATAACACAGTTGGTGG + Intronic
909380508 1:74992435-74992457 AAGGGGAACAACACAGTTTGGGG + Intergenic
910812612 1:91253585-91253607 CTGTGAAATAACAGAGATGGTGG - Intergenic
910899011 1:92099330-92099352 CTTGCAAATAACAAAGTTGGTGG - Intronic
911855155 1:102867387-102867409 CAGTGAAAGAACACAGGTGATGG - Intergenic
912330534 1:108816552-108816574 CAGGGAAACAGCCCAGCTGGCGG - Intronic
912609525 1:111029088-111029110 CAGGGAGGGAAAACAGTTGGAGG + Intergenic
913307535 1:117448414-117448436 CATGGAAATAACAGAGGTGATGG + Intronic
916058072 1:161081630-161081652 CAGGGACAACACACTGTTGGGGG - Intronic
916451214 1:164922271-164922293 CATGGTAATAACAAAGTTGCTGG + Intergenic
917123863 1:171668602-171668624 TAGTGAAATAACACAGGTGCGGG - Intergenic
918464587 1:184808377-184808399 GAGGAAAATAAGACAGTTGAAGG - Intronic
918712809 1:187752007-187752029 CAAGGAAATAACAGAGTTTTAGG + Intergenic
919493131 1:198229689-198229711 CAGAGGAAAAACACAGTTTGTGG + Intronic
921200576 1:212801551-212801573 CACAGAAATTACACAGTTGGAGG - Intronic
921805202 1:219446154-219446176 CAGGGAAATATGTGAGTTGGGGG - Intergenic
921925711 1:220708524-220708546 GAGGGAAACATCACACTTGGGGG + Intergenic
922418129 1:225440456-225440478 CAGGAAAATAACTCAGGTGGAGG + Intergenic
923421028 1:233815107-233815129 AAAGGAAAATACACAGTTGGTGG + Intergenic
923459912 1:234200014-234200036 CAGGGACAACACACTGTTGGTGG + Intronic
923758917 1:236821313-236821335 CAGGGAACTAACACAGTCTCTGG + Intronic
1064006812 10:11705323-11705345 AAGGGAAATAACACAGCTCGTGG - Intergenic
1064025872 10:11848467-11848489 AAGGGAAAGAACAGAGTGGGGGG - Intronic
1064783391 10:18867424-18867446 CATTGAAATATCAAAGTTGGAGG + Intergenic
1068548003 10:58373306-58373328 CTGTGAAAGAACAGAGTTGGAGG - Intergenic
1068651276 10:59525646-59525668 CAAGGCAGAAACACAGTTGGGGG - Intergenic
1071376227 10:85007394-85007416 CATGGAAGTAACCCAGTGGGAGG - Intergenic
1071925625 10:90405367-90405389 TAGGAAAAGAACACAGTAGGGGG + Intergenic
1071959102 10:90791702-90791724 AAGTGAAATAAAACACTTGGAGG - Intronic
1072275883 10:93822660-93822682 GAGGAAAAAAACAAAGTTGGAGG + Intergenic
1072382175 10:94884911-94884933 CAGCAAAATAACAAAGCTGGAGG + Intergenic
1072493048 10:95927846-95927868 CAGGGAGACTACACAGTTTGAGG - Intronic
1074341048 10:112630388-112630410 CAGGAAAATATTACACTTGGGGG + Intronic
1075595447 10:123725831-123725853 ATGGGAAAGAAAACAGTTGGTGG - Intronic
1078478897 11:11659112-11659134 CAGGGAAACAGCACAAATGGAGG - Intergenic
1079137162 11:17782043-17782065 CAGGGTAATCATACAGTTGCAGG - Exonic
1080887771 11:36382250-36382272 CATGGAGATAACACAGGTTGAGG + Intronic
1081186419 11:40048339-40048361 CAGGCAATTCACCCAGTTGGTGG + Intergenic
1081520319 11:43875250-43875272 AAGGGGAATAAGACATTTGGTGG + Intergenic
1082730115 11:56785609-56785631 CAGGAGAATAAGTCAGTTGGAGG + Intergenic
1088534288 11:110843099-110843121 CAGGGAAATAACACACACTGAGG - Intergenic
1088913376 11:114208992-114209014 CAAGGGAATTACACAGTTTGGGG - Intronic
1091342814 11:134831540-134831562 AAGGGGAATAACAAAGTTGGAGG + Intergenic
1091962247 12:4705850-4705872 AAGGCAAAAAACACAGTTTGAGG + Intronic
1092814631 12:12302077-12302099 CAGGAAAATAAAGAAGTTGGTGG + Intergenic
1093285128 12:17250056-17250078 TTTGAAAATAACACAGTTGGAGG + Intergenic
1093440370 12:19188308-19188330 GAGGGAAATAACAATTTTGGGGG - Intronic
1097590764 12:61572304-61572326 AAAAGAAATAACACAGTTGGGGG - Intergenic
1099895171 12:88636111-88636133 AAGGAAAAGAACAAAGTTGGAGG - Intergenic
1102579672 12:113878416-113878438 CAGGTAAATGACACATTGGGAGG - Intronic
1104361522 12:128137658-128137680 GAGGAAATTAACACATTTGGAGG - Intergenic
1104601841 12:130160416-130160438 TTGGGAAATAACACAGTTGAAGG + Intergenic
1104937831 12:132375956-132375978 CAGGGAATTCACACTGTTGTGGG + Intergenic
1105614450 13:21999699-21999721 CAGGGAAAGAAGAGAGGTGGAGG + Intergenic
1106342179 13:28841030-28841052 CAAGGACATCACACAGGTGGTGG - Intronic
1107122961 13:36815213-36815235 CAGGGTAATACCAAAGTTGAAGG + Intergenic
1107524100 13:41213453-41213475 CAGGGCAATTACACTGGTGGTGG - Intergenic
1109695212 13:65946974-65946996 CTTGGAAAAAACACAGTTTGGGG - Intergenic
1112493740 13:99889286-99889308 CAGGGCCATAACCCACTTGGTGG + Intronic
1114595797 14:23910677-23910699 CAGAGAAATCACACAGTTGCTGG + Intergenic
1116041310 14:39689500-39689522 AAGTGAAATACCACAGCTGGGGG + Intergenic
1116503619 14:45650985-45651007 ATGGAAAATAACACAGCTGGAGG - Intergenic
1116519469 14:45831854-45831876 TAGGAAAATATCACAGTGGGGGG + Intergenic
1116974350 14:51099081-51099103 TGAGGAAATAACACAGGTGGAGG + Intergenic
1118117040 14:62790339-62790361 CTGAGAAAGAACAAAGTTGGAGG - Intronic
1119589992 14:75877482-75877504 CAGAGAAAAACCACAGTTTGAGG - Intronic
1120426360 14:84352602-84352624 CACAAAAAGAACACAGTTGGAGG + Intergenic
1121392562 14:93588810-93588832 CAGAGAAAGAAAACAGTTAGTGG + Intronic
1122780787 14:104142589-104142611 CAGGGACATCTCAGAGTTGGGGG - Intronic
1124253906 15:28125486-28125508 CTGAGAACTAACACTGTTGGAGG - Intronic
1125135796 15:36341471-36341493 AAGGCAAAAAACACAGTTTGAGG - Intergenic
1126180262 15:45778448-45778470 CAGGGAAATAACACAATCATCGG + Intergenic
1126311548 15:47322775-47322797 TTGGGAAATATCACAGTTGCTGG - Intronic
1126613414 15:50552169-50552191 GAAGGAAATAAAAAAGTTGGAGG - Intergenic
1128104407 15:65032723-65032745 TAGGGAAATAACCCACTTGGTGG + Intergenic
1128196076 15:65757538-65757560 CAGGGAGATAATAAAGTTGTAGG + Intronic
1128376798 15:67082359-67082381 CAGGAAAATAAGACTGGTGGAGG - Intronic
1128595278 15:68940567-68940589 AAGGGAAAAAACAGAGATGGAGG - Intronic
1131951578 15:97687190-97687212 CAGGGAAAGAGCACAGACGGAGG - Intergenic
1135761300 16:25140368-25140390 CAGGGCAAAAAAAAAGTTGGTGG - Intronic
1136018308 16:27421245-27421267 TTGAGAAAGAACACAGTTGGAGG - Intronic
1137064254 16:35822531-35822553 TAGGGGAATAACAAAATTGGAGG - Intergenic
1138372452 16:56538061-56538083 CAGGGAACTATCTCAGTGGGGGG - Intergenic
1138380703 16:56600390-56600412 CAGGAAAAGAACAAAGTTGGAGG - Intergenic
1141468310 16:84221669-84221691 TAGGGAAATATCACTGGTGGTGG + Exonic
1144682972 17:17207087-17207109 CAGGGAATCAACACAGCTGGAGG + Intronic
1144837333 17:18163565-18163587 CAGGGAAAGAACACAGCTTGTGG - Intronic
1145913182 17:28554345-28554367 CAGGGAAATAAAGGAGGTGGAGG + Exonic
1147197049 17:38774011-38774033 TAAGGAAAGAACATAGTTGGGGG + Intronic
1148683341 17:49486973-49486995 CAGGGCAAGGACACAGGTGGAGG - Intergenic
1149117310 17:53112996-53113018 GAGGGAAATAACACAGTAGGTGG - Intergenic
1149524742 17:57346330-57346352 CATGTAAATAACACATTTTGGGG + Intronic
1151506974 17:74534564-74534586 CAGGGAAAGAAAATAGTTGGGGG + Intergenic
1155181990 18:23356035-23356057 CAGGGATATAGGCCAGTTGGAGG - Intronic
1156365123 18:36418999-36419021 GGGGGAATTAACACAGTGGGAGG + Intronic
1158261881 18:55615035-55615057 CAGACAAAGAACAGAGTTGGGGG - Intronic
1159329257 18:66968586-66968608 AAGGTAAATAACATATTTGGGGG - Intergenic
1159818410 18:73107291-73107313 CAGGAAAAGAACAAAGTTAGAGG - Intergenic
1160083864 18:75756013-75756035 CAGGAGAAGAACACAGTTGTGGG - Intergenic
1160222505 18:76987522-76987544 CAGGGAAAGAAAACAGAAGGTGG - Intronic
1160470533 18:79128739-79128761 CAGTGAAATGGCAGAGTTGGCGG + Intronic
1162446161 19:10724139-10724161 GAGGGAGAGATCACAGTTGGAGG + Intronic
1163332118 19:16646326-16646348 CAAGCAAATCACACAGTTGTGGG + Exonic
1164713626 19:30376288-30376310 CAGGGCAAAGACACAGATGGAGG - Intronic
1164876349 19:31693437-31693459 CAGGGAAATGACAGGGTTGCTGG - Intergenic
1165850458 19:38847515-38847537 CAGTCAGATAAAACAGTTGGAGG + Intronic
1166438869 19:42793038-42793060 CAAGGAGAGAAAACAGTTGGGGG - Intronic
1166473874 19:43103825-43103847 CAAGGAGAGAAAACAGTTGGGGG - Intronic
1166494660 19:43290759-43290781 CAAGGAGAGAAAACAGTTGGGGG - Intergenic
925570127 2:5301483-5301505 GAGGGAAAACACACAGATGGTGG - Intergenic
925689622 2:6507663-6507685 CAGAGAAATAGCACAATGGGAGG + Intergenic
925693571 2:6550207-6550229 AATGGAAAAAACAAAGTTGGAGG + Intergenic
926839411 2:17062594-17062616 AAGGAAAGTAACACAGTGGGGGG - Intergenic
928142092 2:28738736-28738758 AAGAGAAAGAACAAAGTTGGTGG - Intergenic
930259589 2:49129567-49129589 CAGGGAAATAACACAGTGTTAGG + Intronic
932882096 2:75512336-75512358 CAGGGAAATAAAACATATGTGGG + Intronic
933800041 2:85953467-85953489 TAGGGAGATCTCACAGTTGGGGG + Intergenic
935178820 2:100672658-100672680 CAGGGCAAGAACACAAATGGAGG + Intergenic
935329198 2:101963988-101964010 CAGTTAACTAACACAGATGGTGG - Intergenic
935729647 2:106054971-106054993 CAGGGAAAGAAAACAGCAGGAGG - Intergenic
935863778 2:107363005-107363027 CTGGGAAATTACACGCTTGGAGG + Intergenic
937724053 2:125138734-125138756 CAGGGAAATATCATATTTGAAGG - Intergenic
938009857 2:127820339-127820361 CAAGGAAGAAAAACAGTTGGGGG + Intergenic
938143740 2:128817271-128817293 CAGGAAGATACCACAGCTGGAGG - Intergenic
938213220 2:129485874-129485896 CAGGGCAAGAACACAAATGGAGG + Intergenic
941168091 2:162104850-162104872 TAGGAAACTAACACAGCTGGTGG - Intergenic
942032003 2:171972057-171972079 CAGGTACATTACACAGTAGGGGG - Intronic
943822408 2:192342621-192342643 AAGGAGAAGAACACAGTTGGAGG - Intergenic
944163007 2:196686373-196686395 TAGGAAAATAACACCGTTGGAGG - Intronic
945686339 2:212975019-212975041 CAGGGAAAAATCACATTTGGGGG + Intergenic
945929300 2:215839413-215839435 CAGGGTAAAAAGACAGGTGGAGG + Intergenic
947080000 2:226385489-226385511 CAGAAAAAAAGCACAGTTGGAGG - Intergenic
948350999 2:237340785-237340807 CAGGGGAATGACACAGTTGCAGG - Exonic
948485205 2:238276387-238276409 AGGGAAAAGAACACAGTTGGAGG - Intronic
948659656 2:239499167-239499189 CATGGGAACAACACAGGTGGAGG + Intergenic
1169022326 20:2339570-2339592 CAGGGAAGTAACAGTGTTGTTGG + Intronic
1169663900 20:8012479-8012501 CAGAGCAAGAACACAGATGGAGG + Intronic
1176660725 21:9632913-9632935 AAGGAAAAGAACACAGCTGGAGG - Intergenic
1177075960 21:16573759-16573781 CTGGGAATTCACACAGTTTGGGG - Intergenic
1178623985 21:34200412-34200434 CAGAGACAAAACACAGCTGGTGG - Intergenic
1180794606 22:18596072-18596094 GAGGAAAATAAAACAGGTGGGGG + Intergenic
1181227133 22:21399249-21399271 GAGGAAAATAAAACAGGTGGGGG - Intergenic
1181251517 22:21535594-21535616 GAGGAAAATAAAACAGGTGGGGG + Intergenic
1182692653 22:32174882-32174904 GAGAGACATAACACCGTTGGAGG - Intergenic
1183171751 22:36193502-36193524 CAGGGAAAGAACACAGATTAAGG - Intronic
949151969 3:780016-780038 CATGGAAATTACAGTGTTGGTGG - Intergenic
951188024 3:19736386-19736408 CAAGGAAGGAACACAGCTGGGGG + Intergenic
954594205 3:51811376-51811398 CAAGGTAACAACAGAGTTGGAGG - Intergenic
955557326 3:60151883-60151905 CAGGGAAATTATATAGTTGCAGG - Intronic
955710336 3:61772178-61772200 CTGGGAAATTATACAGTTGAGGG + Intronic
957491572 3:80933766-80933788 AAGCGAAATAACAAAGCTGGAGG + Intergenic
959178546 3:102949251-102949273 AAGTGAAATAATACATTTGGAGG + Intergenic
961618323 3:128202126-128202148 CTGGAAAAGAACAAAGTTGGAGG - Intronic
962029907 3:131588930-131588952 CAGGGAATTAACATAATTAGTGG - Intronic
964750299 3:160048257-160048279 CAGGAAACTAATACAGTTGGTGG + Intergenic
964750527 3:160049992-160050014 CAGGAAATTAATACAGTTGGTGG - Intergenic
966120426 3:176513794-176513816 CAAGGAAGGAAAACAGTTGGGGG - Intergenic
966374948 3:179286852-179286874 CAGAGAAATGAGAAAGTTGGGGG + Intergenic
968635759 4:1678009-1678031 CAGGAGAAGAACAAAGTTGGAGG + Intronic
968874997 4:3262049-3262071 CAGGGAAATAAGGCTGTAGGGGG + Intronic
969109468 4:4833891-4833913 AAGGAAAAGAACAAAGTTGGAGG + Intergenic
970820522 4:20206124-20206146 CAGGGCAGTAACACACATGGAGG + Intergenic
971497027 4:27277555-27277577 CAGGGAAAAAACCAACTTGGGGG + Intergenic
972222037 4:36966809-36966831 CAGGGAGATCACACAGGAGGAGG - Intergenic
973203602 4:47533846-47533868 CAGTGAAATTACACAGTGGAGGG - Intronic
974475028 4:62367423-62367445 AAAGGAAATAACAAAATTGGAGG + Intergenic
975002882 4:69247137-69247159 CAGGGAACTCACACTGATGGGGG - Intergenic
975011166 4:69354495-69354517 CAGGGAACTCACACTGATGGGGG - Intronic
977309980 4:95373956-95373978 CAGGAAAAGATCACAGTTGGAGG - Intronic
977417681 4:96755135-96755157 CAGGGAACTGAAAAAGTTGGTGG - Intergenic
978195777 4:105970251-105970273 CAGGGAGGAAATACAGTTGGGGG - Intronic
978992228 4:115098534-115098556 AAGGAGAATAACAAAGTTGGAGG + Intronic
979600529 4:122582490-122582512 CAGGGAAATAGCACAGGTTTTGG - Intergenic
982459964 4:155656829-155656851 CAATGAAAGAACGCAGTTGGAGG - Intergenic
982666133 4:158266117-158266139 GAAGGAAAGAACAAAGTTGGAGG - Intergenic
983572343 4:169223757-169223779 CAGGGTAAGAGCACAGTGGGTGG + Intronic
983759194 4:171384571-171384593 CAGGGAAACCACATAGTTTGGGG - Intergenic
985036077 4:185841199-185841221 CTGGGTAATAACACAGTCAGAGG + Intronic
985414637 4:189723502-189723524 AAGGAAAAGAACACAGCTGGAGG + Intergenic
986423533 5:7608255-7608277 CAGGGAAATAACACAGTTGGAGG + Intronic
988458955 5:31415175-31415197 AAGGGAAAAACCACAGCTGGGGG + Intronic
988869266 5:35370871-35370893 CAGAGAAATACTAAAGTTGGAGG + Intergenic
990214845 5:53519052-53519074 CATGTAAATAACACAGTTTGTGG - Intergenic
990836058 5:60021563-60021585 CAGGAAAATGACACATTTGAGGG + Intronic
991659256 5:68933847-68933869 CTGGGAAACAAGATAGTTGGAGG - Intergenic
993812817 5:92503976-92503998 ATGGGAAATAACACAATTGGAGG - Intergenic
996042866 5:118835975-118835997 CTTGCAAATAACACATTTGGAGG + Intergenic
996965064 5:129298307-129298329 AAGGGAAAGAACAAAGCTGGAGG - Intergenic
997304481 5:132827671-132827693 AAGGGAAATAACAGATTTGCAGG + Intronic
997820914 5:137064887-137064909 CAGGATAAGAACACATTTGGGGG - Intronic
998055343 5:139071391-139071413 GAGGGAAATATTACAGTTGGAGG + Intronic
1000298468 5:159933846-159933868 CAGGAAAACAATCCAGTTGGAGG + Intronic
1002969677 6:2001590-2001612 CAGAAAAAGAACAAAGTTGGAGG + Intronic
1003361949 6:5435312-5435334 CAGGGAGAGAACACACATGGTGG - Intronic
1004340939 6:14806854-14806876 CTGGGAAAAGAAACAGTTGGAGG + Intergenic
1005028407 6:21486472-21486494 CAGTGAAATAAAACAGGAGGAGG - Intergenic
1006165862 6:32064581-32064603 CAGGAAAATAACACAGACTGAGG - Intronic
1006475414 6:34249459-34249481 CAGGGAACAAACACAGACGGAGG - Exonic
1007045611 6:38771141-38771163 CAGGGAATTAGCGAAGTTGGGGG - Intronic
1007090753 6:39183390-39183412 CTGGGTAATAACACTGTTGTGGG + Intergenic
1008778705 6:55073739-55073761 AAGGCAAAAAATACAGTTGGAGG + Intergenic
1008802988 6:55392694-55392716 GAGGGGAACAACACACTTGGGGG + Intronic
1009533448 6:64850538-64850560 AAGGGAAATAAGACAGCAGGAGG + Intronic
1009683300 6:66925626-66925648 CAGGGAGGGAACATAGTTGGGGG - Intergenic
1010123004 6:72401089-72401111 CAGGGAAATAACACTGCTTGTGG - Intronic
1012198028 6:96368736-96368758 CAGTGAAATGACACAGCAGGAGG - Intergenic
1012247684 6:96944054-96944076 CAGGGAACGAATACAGCTGGGGG - Intronic
1014582570 6:123157095-123157117 CAGTGAAATCAACCAGTTGGAGG + Intergenic
1014768978 6:125439625-125439647 TAGAGAAATAACTCTGTTGGTGG - Intergenic
1014952254 6:127569850-127569872 GAGGGAAATAAATCAGTAGGTGG - Intronic
1016504833 6:144767083-144767105 CAGAGAAATAAACCAGTTTGGGG + Intronic
1018608062 6:165620100-165620122 CAGGGAAATAATACAATTAATGG - Intronic
1018881969 6:167893005-167893027 CAGGTAATTCACACAGTGGGAGG + Intronic
1019364977 7:628592-628614 CAGGAAAACCACACAGCTGGGGG + Intronic
1019827036 7:3292962-3292984 AAGGGAGAGAACACAGGTGGAGG - Intergenic
1020110311 7:5444085-5444107 TAGGGAATGAACACAGTAGGTGG + Intronic
1020206249 7:6119243-6119265 CGGAGAAAGAACAAAGTTGGAGG - Intronic
1020232186 7:6327858-6327880 AAAGGAAATAAAACAGTTGGTGG + Intergenic
1020579557 7:9978758-9978780 CAGGGAAAGAACAAATTAGGTGG - Intergenic
1021104398 7:16620255-16620277 CAGGCAAATCACACAGCTGGTGG + Intronic
1022084973 7:27057797-27057819 GAAGGAAATAAGACAGTAGGAGG - Intergenic
1023417765 7:39949244-39949266 GAGGGAAATAATGCTGTTGGTGG - Intergenic
1026027759 7:66761091-66761113 CAGAGGAAAAACACAGTTTGAGG - Intronic
1026692017 7:72557649-72557671 CAGGGAAACAACACATTTCTGGG - Intergenic
1027631898 7:80617202-80617224 CAGGGGAACAACACACATGGGGG + Intronic
1028816309 7:95149907-95149929 AAGGGAAATAACAAAGTTGGAGG + Intronic
1030653204 7:112138146-112138168 AAGGGAAATAACAGAATAGGAGG - Intronic
1032108326 7:129054007-129054029 CAGAGAAATAACAAGGTTAGAGG + Intronic
1033986499 7:147232392-147232414 CTGGGAAATAACAAAGCTGGAGG + Intronic
1035289866 7:157831001-157831023 CAGGTAAATGACAGAGTTGCAGG + Intronic
1036098876 8:5755764-5755786 AAGGTAAATAACACAGGTGGGGG - Intergenic
1036419962 8:8586308-8586330 AAGTGAAACAACACAGCTGGAGG - Intergenic
1039027721 8:33276111-33276133 CAGAGACAGAACACAGTAGGGGG + Intergenic
1041896887 8:62935199-62935221 CAGGGACACAACACTGTTCGGGG + Intronic
1042354537 8:67812035-67812057 CAGGGGAACAACACACATGGGGG - Intergenic
1042972055 8:74420094-74420116 CAGAAAAAGAACAAAGTTGGAGG - Intronic
1045202962 8:100005729-100005751 GAGGAATATAACACAGTTGAAGG + Intronic
1047164216 8:122418814-122418836 AAGGGAAATAACAGAGCTTGGGG - Intergenic
1047187530 8:122647341-122647363 CAGGCAAATGACAGAGTTGTGGG - Intergenic
1048665774 8:136658974-136658996 CAGGGAAATAATAAAGTTAGGGG + Intergenic
1051457584 9:17277861-17277883 CAGGGAAATATCAAAGTTCATGG + Intronic
1055128225 9:72744020-72744042 TAGGGAGATAACACAGCTGATGG + Intronic
1061309517 9:129753069-129753091 CAGGGAAAGCACAAAGTGGGAGG + Intergenic
1061504141 9:131021501-131021523 CAGAGGAAAAACACAGTTTGAGG - Intronic
1062189211 9:135238861-135238883 CAGGGAAACAGCACAGTCTGAGG + Intergenic
1203638293 Un_KI270750v1:134757-134779 AAGGAAAAGAACACAGCTGGAGG - Intergenic
1187565516 X:20445718-20445740 CAGTGAAATAATAGAGCTGGTGG + Intergenic
1188578134 X:31678356-31678378 CAGGGAAGTAACATGGTAGGAGG - Intronic
1188596699 X:31910056-31910078 AAGGAAAATCACACAGATGGTGG + Intronic
1190081713 X:47361892-47361914 CAGGTAAATAGCACAGCTGGAGG - Intergenic
1193413277 X:81191003-81191025 AAGGAAAAGAACAGAGTTGGAGG - Intronic
1196080646 X:111627170-111627192 AAGGGAACTTACACTGTTGGTGG + Intergenic
1198435974 X:136617157-136617179 GTGGCAAATAACACAGGTGGTGG + Intergenic
1198739046 X:139821124-139821146 CAGGGAAAAAACACAAAAGGAGG + Intronic
1200971477 Y:9157138-9157160 CAGGAAAGAAACACAGTTGAAGG + Intergenic
1201736432 Y:17267728-17267750 GAGGGAAATAACACAGACTGGGG + Intergenic
1202139543 Y:21707156-21707178 CAGGAAAGAAACACAGTTGAAGG - Intergenic