ID: 986429193

View in Genome Browser
Species Human (GRCh38)
Location 5:7664979-7665001
Sequence CAAAGTGAGGAGGAGGGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 989
Summary {0: 1, 1: 0, 2: 7, 3: 101, 4: 880}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986429193 Original CRISPR CAAAGTGAGGAGGAGGGGGC GGG (reversed) Intronic
900365270 1:2309668-2309690 CACAGGGAGGAGGAGGTGGGGGG - Exonic
900512816 1:3068488-3068510 GAAGGGGAGGAGGCGGGGGCCGG + Intergenic
900564880 1:3327366-3327388 CTAAGGGAGGCAGAGGGGGCAGG - Intronic
901373211 1:8817792-8817814 CAATGGGAGGCGGAGGAGGCGGG + Intergenic
901531793 1:9858348-9858370 CACAGTGAGGAGGTGGGCGTTGG - Intronic
901775550 1:11558428-11558450 CAAAGTGAGAGGGAGGCGGGTGG - Intergenic
901836515 1:11927185-11927207 AAAAGGGAGGAGGAGGGGAAGGG + Intergenic
902199507 1:14823091-14823113 CAGAGGGAGGAGAACGGGGCTGG - Intronic
902213857 1:14922879-14922901 GAAGGTGAGGATGCGGGGGCGGG + Intronic
902237040 1:15064161-15064183 CAGAGTGAGGAGGGGGCTGCAGG + Intronic
902748657 1:18490764-18490786 CAAAGGGAGGAGGAGTAGGTAGG - Intergenic
902791164 1:18769200-18769222 CCAAGGGAGGGGGAGGGGGAGGG - Intergenic
902799259 1:18819339-18819361 CAGAGGGATGGGGAGGGGGCAGG - Intergenic
902823390 1:18956734-18956756 CAGAGGGAGGAGGGGTGGGCGGG - Intergenic
902830762 1:19010774-19010796 AAAAGAAAGGAGGAGTGGGCAGG + Intergenic
903140752 1:21337887-21337909 CAGTGTGGGGAGGAGAGGGCAGG - Intronic
903143680 1:21356006-21356028 CAAAGAGAGGAGGTGTGGGTGGG + Intergenic
903179730 1:21599109-21599131 CAAAGAAAGGAGGAGGCGGCAGG + Intronic
903391987 1:22971215-22971237 CATTTTGAGGAGGAGGGGGGTGG - Intergenic
903471826 1:23592720-23592742 CACAGTGAGGAGGATGGAGGGGG - Intronic
903776507 1:25797531-25797553 AAGAGGGAGGAGGAGGAGGCAGG - Intergenic
903799333 1:25954934-25954956 CAAAGGGAGGAGCTGGGGGCAGG - Intergenic
903864761 1:26389918-26389940 CAGAATGAGGAGGAAGGGGCAGG + Intergenic
904205930 1:28855300-28855322 CGAAGTGGGGAGGTGGGAGCGGG + Intronic
904256557 1:29258479-29258501 GAAAGAGAGGAGGAAGAGGCAGG - Intronic
904306565 1:29593921-29593943 AAGAGGGAGGAGAAGGGGGCAGG + Intergenic
904329129 1:29746472-29746494 CAAAGTGAGGAGGGACTGGCAGG + Intergenic
904367594 1:30024648-30024670 CACAGTGAGAAGGATGGGCCCGG + Intergenic
904671962 1:32172750-32172772 CACAGTGGGGAGGTGGGGGTGGG - Exonic
905012227 1:34755361-34755383 CAAAGGTAGGAGCAGGGGCCAGG + Intronic
905300959 1:36985926-36985948 CACAGTGAGGAGGAGGGGGAGGG - Intronic
905346989 1:37318094-37318116 CAACGGGAGGAGGAAGGGCCCGG - Intergenic
905511593 1:38525828-38525850 CAATGTGGCGAGGAGGTGGCAGG + Intergenic
905708664 1:40082070-40082092 CATTTTGAGGAGGTGGGGGCTGG - Intronic
905855346 1:41307837-41307859 CAGAGTCAGGAGGAGGGACCAGG - Intergenic
907409651 1:54275083-54275105 CATAGTCTGGTGGAGGGGGCAGG - Intronic
908061495 1:60354956-60354978 CAAAATGGGGTGGAGGGGGAGGG + Intergenic
908189239 1:61684378-61684400 CACAGTGAGGAGAAGTGGGAAGG - Intronic
908318839 1:62961628-62961650 CAGAATGGGGAGGAGGGGGGTGG - Intergenic
908372318 1:63495576-63495598 CAAAGAAAGTAGGATGGGGCAGG + Intronic
908645308 1:66272018-66272040 CAAAGGGTGGAGGAGGAAGCTGG + Intronic
909585208 1:77281848-77281870 CGAGGTGCGGAGGTGGGGGCGGG - Intergenic
910406467 1:86896248-86896270 CAAAGAGGGGGGGAGGGGGAGGG + Intronic
910795421 1:91092734-91092756 CAGAGAGAGGAGGAAGGGGTGGG - Intergenic
912472091 1:109912870-109912892 GAAAGTGTGGAAGAGGGGGACGG - Intronic
912493829 1:110078544-110078566 AAATGTGAGCAGGAAGGGGCTGG + Intergenic
912512944 1:110200890-110200912 CAAGAGGAGGAGGAGGAGGCAGG - Exonic
912623763 1:111191200-111191222 CTAAGGAAGGATGAGGGGGCCGG + Intronic
912643499 1:111369539-111369561 TAGGGTGAGGAGAAGGGGGCAGG - Intergenic
913517373 1:119615964-119615986 TAAAGTGGGGTGGGGGGGGCGGG + Intergenic
913540273 1:119813193-119813215 CAAAGTGACAAGGATGGGGATGG + Intergenic
913573070 1:120141019-120141041 CAAGGTGAGGAGGAGAGGAGAGG - Intergenic
913939863 1:125091643-125091665 AAAAAGGAGGAGGAGGGGGAAGG + Intergenic
913979212 1:143493449-143493471 AAAAAGGAGGAGGAGGGGGAAGG - Intergenic
914043603 1:144072783-144072805 AAAAAGGAGGAGGAGGGGGAAGG - Intergenic
914073615 1:144319099-144319121 AAAAAGGAGGAGGAGGGGGAAGG - Intergenic
914105540 1:144647261-144647283 AAAAAGGAGGAGGAGGGGGAAGG + Intergenic
914134484 1:144887708-144887730 AAAAAGGAGGAGGAGGGGGAAGG + Exonic
914667171 1:149841356-149841378 GAAAGTGAGGCGGGGTGGGCGGG - Intergenic
914668596 1:149852434-149852456 GAAAGTGAGGCGGGGTGGGCGGG + Intronic
914681764 1:149943892-149943914 AGAACTGAGGAGGAGGGAGCGGG - Exonic
914850491 1:151310275-151310297 CAAAGGGAGAAGGAGGGGGTGGG + Intronic
914869196 1:151459039-151459061 CAATGAGAGGGGGATGGGGCCGG - Intronic
914960132 1:152197623-152197645 GAAAGAAAGGAGGAGGGGGGAGG - Intergenic
915124305 1:153652758-153652780 GAAAGGGAGGAGGAGAGGACAGG - Intergenic
916412348 1:164559050-164559072 CAAAGGGAAGGGGAGGGGGCGGG - Intronic
916563094 1:165949899-165949921 AAAAGAGAGGAGGAAGGGGAAGG - Intergenic
917610638 1:176685669-176685691 CCTGGTGGGGAGGAGGGGGCCGG - Intronic
917616878 1:176754947-176754969 AAAAGTGAGAAGCAGGGGTCTGG - Intronic
919822454 1:201481841-201481863 CAGAGAGAGGAGGAGGGCGTGGG + Intergenic
919921109 1:202166982-202167004 CAAGGTGAGGGGGAGGAGGGAGG - Intergenic
920211705 1:204333176-204333198 CAGAGTGAGGAAGAAGGGGAAGG + Intronic
920430929 1:205918472-205918494 GAAAGAGATGAGGAGGAGGCAGG + Intronic
920433983 1:205936491-205936513 AAAAGTGAGGAGGAGAGGAGCGG - Intronic
920525005 1:206659898-206659920 GAAGGGGTGGAGGAGGGGGCAGG - Intronic
920840563 1:209550369-209550391 TAAGGTGGGGAAGAGGGGGCTGG - Intergenic
920885726 1:209926033-209926055 CCAAGTAAGGAGGAGGGGAAAGG + Intergenic
920913330 1:210237401-210237423 AAACGAGAGGAGGAGGGTGCAGG + Intronic
921458055 1:215395410-215395432 AAAAATGAGGAGGAGTTGGCTGG - Intergenic
921882683 1:220272383-220272405 CGCAGTGGGGTGGAGGGGGCAGG - Exonic
922668229 1:227490665-227490687 CAGAGGGAAGAGGAGGAGGCAGG - Intergenic
922883675 1:229001850-229001872 GAAAGTCAGGAGGTGGGGGTGGG + Intergenic
923014107 1:230112670-230112692 CGAAGGGAGGAGGAGGGAGAGGG + Intronic
923152072 1:231242077-231242099 CCAAGAGAGGAAGAGGGGGTTGG - Intronic
923342101 1:233016378-233016400 CAAAAAGAGGAGAAAGGGGCAGG - Intronic
1063040304 10:2331349-2331371 TAAAGCGAGGAGAAGGGGGAGGG + Intergenic
1063058077 10:2524011-2524033 CAAAGCGAGGAGGGGGAGGAGGG - Intergenic
1063178399 10:3572542-3572564 AAATGTTAGGAGGAGGTGGCTGG - Intergenic
1063225759 10:4013414-4013436 CAAAGTGGGGAGGAGAAGGAAGG - Intergenic
1063920290 10:10925938-10925960 AAAGGTGAGGAGGTAGGGGCTGG - Intergenic
1064462802 10:15551259-15551281 GAGAGAGAAGAGGAGGGGGCTGG + Intronic
1065081046 10:22129932-22129954 GAAAGTGATGGGGAGGGGGGAGG - Intergenic
1065687672 10:28302667-28302689 CCTTGTGAGGAGGTGGGGGCGGG - Intronic
1065819143 10:29509309-29509331 GAAAGGGAGAAGGAGGGGGAGGG + Intronic
1066101479 10:32122121-32122143 CAACATGATGAGCAGGGGGCAGG + Intergenic
1066104688 10:32146208-32146230 GATGGTGAGGAGGAGTGGGCAGG - Intergenic
1066382575 10:34913731-34913753 GAAAGAGAGGAGGAGAGGGGAGG + Intergenic
1066610674 10:37244886-37244908 CAGAGTGAGGAGTTGGGGCCTGG - Intronic
1066780271 10:38938142-38938164 AAAAAGGAGGAGGAGGGGGAGGG - Intergenic
1066956019 10:42173428-42173450 AAAAAGGAGGAGGAGGGGGAGGG - Intergenic
1068117785 10:52752962-52752984 CAGAGTGAGGAGCAGTGAGCAGG - Intergenic
1068118664 10:52762113-52762135 CAAAGTGAGTAGCGGGGAGCTGG - Intergenic
1068411942 10:56667599-56667621 GAAAGGGAGGGGGAGGGGGAAGG - Intergenic
1069274021 10:66567027-66567049 CAAAGGGAAGGGGAGGGGGTAGG + Intronic
1069302776 10:66928553-66928575 CAAAGTGAGAGGGAGAGGGAAGG - Intronic
1069621714 10:69841268-69841290 GAAATTGGGGAGGTGGGGGCAGG - Intronic
1069780839 10:70954401-70954423 GAAGATGAGGAGGAGGAGGCCGG - Intergenic
1069813238 10:71177984-71178006 CACAGTGAGGATGAGTGGGGTGG - Intergenic
1069839006 10:71327706-71327728 CAAAGTGTGGGGGTGGGGGGTGG - Intronic
1069840397 10:71335953-71335975 GGAAGTGTGGAGGTGGGGGCGGG + Intronic
1070053193 10:72909080-72909102 AAAAGGTAGGAGGAGGGAGCAGG - Intronic
1070257756 10:74825932-74825954 GAGAGGGTGGAGGAGGGGGCGGG + Intronic
1070337245 10:75466675-75466697 GAAAATGCTGAGGAGGGGGCAGG - Intronic
1070463226 10:76690951-76690973 CATGGGGAGGAGGAGGGGGAGGG - Intergenic
1070548341 10:77470314-77470336 CAAACTGAGGAGGTGAGGCCCGG + Intronic
1070649510 10:78224775-78224797 CGCAGTGAGGAAGAGGGGGTGGG + Intergenic
1070717653 10:78734211-78734233 GAAAGAGAAGAGGAGGAGGCAGG + Intergenic
1070981189 10:80649557-80649579 GAAGCTGAGGAGGAGGAGGCTGG + Intergenic
1071400885 10:85269549-85269571 GAGAGAGAGGAGGAGGTGGCAGG + Intergenic
1071554216 10:86590010-86590032 ACAAGAGAGGAGGAGGGGCCAGG + Intergenic
1072147143 10:92651659-92651681 AAAAGTGGGTAGGAGGGGCCGGG - Intronic
1072536492 10:96368274-96368296 GAAAATGAGGAGGATGGGACAGG + Intronic
1072618000 10:97062581-97062603 CAGGGTGAGGAGGAGTCGGCAGG + Intronic
1072667943 10:97408090-97408112 CTAAGTGAGGAGGACAGAGCAGG + Intronic
1072691293 10:97573720-97573742 TAAAGTGAAGAGTAGGGGCCGGG - Intronic
1072751034 10:97979004-97979026 CTGAGTGAGGAGATGGGGGCAGG + Intronic
1073075931 10:100825953-100825975 AAGAGTGGGGAGGTGGGGGCAGG + Intronic
1073325787 10:102643543-102643565 GAAAGTGGGGAGGAGGGGGCCGG + Intergenic
1073628307 10:105121877-105121899 CACAGGGAGGAGGAAAGGGCTGG - Intronic
1073885846 10:108038716-108038738 CCAACTGAGGAGGAAGGGACAGG + Intergenic
1073894920 10:108144334-108144356 CAGAGGGAGGAGGGGGGGGAAGG - Intergenic
1074253418 10:111776770-111776792 CAAAGTGGGGAGGATGTGGCAGG - Intergenic
1074403168 10:113158397-113158419 AGAAGGGATGAGGAGGGGGCGGG + Intronic
1074476134 10:113776123-113776145 CTAAGGGAGGAAGAAGGGGCTGG + Intronic
1074696239 10:116052207-116052229 CAAGGGGAGGTGGTGGGGGCAGG - Intergenic
1075067971 10:119302517-119302539 CATAGGGTGGAGGATGGGGCTGG + Intronic
1075377373 10:121989489-121989511 GTAAGTAAGGAGGAGAGGGCTGG + Intronic
1075436918 10:122451376-122451398 AAAACTCAGGGGGAGGGGGCAGG - Intergenic
1075721818 10:124591978-124592000 CAAGGTGGGGAGAAGGAGGCAGG - Intronic
1075826352 10:125359852-125359874 GAAAGTGAGGAGCGGGGAGCTGG - Intergenic
1075855499 10:125626170-125626192 AGAAGGGAGGAGGAGGGAGCAGG - Intronic
1076054347 10:127359177-127359199 CAAGGTGAGCAGGAGTGGGTGGG - Intronic
1076291452 10:129349085-129349107 CCCAGTGAGGAGGAGGGAGGGGG + Intergenic
1076595056 10:131620157-131620179 TAAAGAGAGGAGGCGGGGGGGGG + Intergenic
1076930030 10:133525949-133525971 GAAAGAGAGGAGGAGGCGGCAGG + Intronic
1076989835 11:267294-267316 AGAAGTGAGGAGGAGGGGGGAGG + Intergenic
1077380570 11:2235123-2235145 CAAAGGGAGGTGGTGGGGGAAGG - Intergenic
1077522163 11:3042912-3042934 CGAAGTGATGAGGAGGGGCTGGG - Intronic
1078054083 11:7992955-7992977 CACAGTGAGGTGGATGGGGTTGG - Exonic
1079128655 11:17735335-17735357 CAAGGAGAGAGGGAGGGGGCCGG + Exonic
1079249158 11:18774507-18774529 TACTCTGAGGAGGAGGGGGCTGG + Intronic
1079333577 11:19552485-19552507 AAAAGTGAGGAGGAGGGGAGAGG - Intronic
1079405304 11:20140143-20140165 AAGAGGGAGGAGGAGGAGGCGGG - Intergenic
1080116305 11:28624872-28624894 CAATGTTAGGAGGTGGGGCCTGG - Intergenic
1080500050 11:32862003-32862025 TAAAGCGAAGAGGAGGGGGTTGG + Intergenic
1081393586 11:42558924-42558946 GAAAGTGAAGAGGAAGGGGCTGG - Intergenic
1081574470 11:44310518-44310540 AAGAGTGGAGAGGAGGGGGCAGG - Intergenic
1081580957 11:44351437-44351459 CAAAGTCAGGCAGAGGGGGCTGG - Intergenic
1081614086 11:44580099-44580121 CCAGGTGAGAAGGAGAGGGCAGG - Intronic
1081621079 11:44619464-44619486 AAAATTGGGGAGGAGGGGGCCGG + Exonic
1081781890 11:45718858-45718880 TAAAGTGAGGAGTGGGGAGCAGG - Intergenic
1081812596 11:45922286-45922308 ACGAGGGAGGAGGAGGGGGCCGG - Intronic
1081829332 11:46094099-46094121 CAAAGTGATGAGGATGGGACTGG + Intronic
1082295821 11:50440126-50440148 GAAACTGAGGTGGAGGGGGTCGG - Intergenic
1083436847 11:62648669-62648691 CCAAGCGGGGAGGTGGGGGCGGG + Exonic
1083745985 11:64736734-64736756 CACGGTGAGGAGCAGGGGGCAGG - Exonic
1083842419 11:65312149-65312171 CAAGGTGAGGAGGTGAGGGCAGG + Intergenic
1084061365 11:66677622-66677644 CAACGGGAGGAGGCGGGGCCGGG - Exonic
1084069218 11:66723263-66723285 TCAAGAGAGGAGGAGGGGACTGG + Intronic
1084071085 11:66735352-66735374 AAAATTAAGGAGAAGGGGGCTGG + Intergenic
1084166232 11:67375928-67375950 GAAAGAGGGGAGGAGGGAGCTGG + Intronic
1084367432 11:68711826-68711848 CAATGTGATGCTGAGGGGGCCGG + Intronic
1084421196 11:69061529-69061551 CAGAGAGAGGAGGTGGGGGCAGG + Intronic
1084665664 11:70574896-70574918 CAAAATGAAGAGGATGGGGAAGG - Intronic
1084783638 11:71428941-71428963 ATAAGTGAGGAGGAGGCGGGAGG - Intronic
1084870787 11:72097447-72097469 CCAAGTCAGGGAGAGGGGGCAGG + Exonic
1085023845 11:73225250-73225272 CAAAGTCAGGAGGAGGAGCTGGG - Intronic
1085231196 11:74972454-74972476 CACACTTTGGAGGAGGGGGCGGG - Intronic
1085326569 11:75610979-75611001 AGAAGTGAGGAGGAGGGGTGAGG - Intronic
1086037873 11:82438728-82438750 CAAGGTGGGGAGGGGGTGGCAGG + Intergenic
1086180953 11:83950913-83950935 GGAAGTGTGGAGGGGGGGGCAGG - Intronic
1087360255 11:97149761-97149783 CACAGTGAGTAGGAGGATGCTGG + Intergenic
1087914432 11:103793298-103793320 GAAAGTGGGGAGGAGGGAGTGGG + Intergenic
1088881851 11:113979099-113979121 GAAAGTGAAGAGCAGGGGCCGGG - Intronic
1088920260 11:114255468-114255490 CAGAGGGAGGAGGGGAGGGCGGG - Intergenic
1089058787 11:115608996-115609018 CAGAATGAGGAGGAGGGCACAGG - Intergenic
1089126264 11:116178633-116178655 CAGAGTGAGGAAGATGGGGAAGG - Intergenic
1089179965 11:116576709-116576731 GAAAGAGAGGAGGAGGTGCCAGG + Intergenic
1089448370 11:118572345-118572367 CAAAGGGCGGGGGGGGGGGCGGG - Intronic
1089520056 11:119057287-119057309 CAAAGGGAGGGGGCGGGGCCTGG - Intergenic
1089642849 11:119859132-119859154 CAGGGTTAGGATGAGGGGGCAGG + Intergenic
1089965666 11:122653166-122653188 CAAAGAGAGAAGAGGGGGGCTGG - Intergenic
1089983334 11:122790334-122790356 CAGAGTGAGGGAGAGGGGGAGGG - Intronic
1090367303 11:126217620-126217642 TAAAGGCAGGAGGAGGGGGCAGG - Intronic
1090446206 11:126766887-126766909 CAAAGTGAGGCACAGAGGGCTGG + Intronic
1090480277 11:127061760-127061782 CAAAGAAAGGAGAAGGGGGAAGG - Intergenic
1090745631 11:129702690-129702712 CAAGATGAAGAGGAGGGGGACGG + Intergenic
1090817948 11:130314943-130314965 GAAGGGGAGGAGAAGGGGGCGGG + Intergenic
1090964840 11:131589667-131589689 AAAAGTGACGAGGAAGGGGTGGG - Intronic
1091034355 11:132219809-132219831 GGGAGTGAAGAGGAGGGGGCTGG - Intronic
1091337122 11:134780619-134780641 AAGAGTGAGGAGGAGGAGGAGGG - Intergenic
1091568073 12:1662437-1662459 GGAAGTGAGGAGGGGGAGGCGGG - Intergenic
1091568081 12:1662458-1662480 GGAAGTGAGGAGGGGGAGGCGGG - Intergenic
1091568144 12:1662600-1662622 GGAAGTGGGGAGGAGGAGGCGGG - Intergenic
1091568152 12:1662621-1662643 GGAAGTGAGGAGGGGGAGGCGGG - Intergenic
1091568160 12:1662642-1662664 GGAAGTGAGGAGGGGGAGGCGGG - Intergenic
1091568168 12:1662663-1662685 GGAAGTGAGGAGGGGGAGGCGGG - Intergenic
1091568186 12:1662705-1662727 GGAAGTGAGGAGGGGGAGGCGGG - Intergenic
1091568194 12:1662726-1662748 GGAAGTGAGGAGGGGGAGGCGGG - Intergenic
1091751852 12:3027260-3027282 CAAAGAAAGGAGCAGGAGGCTGG - Intronic
1092230343 12:6772608-6772630 CAGCCTGAGGAGGTGGGGGCGGG - Exonic
1092509936 12:9144208-9144230 GAAAGTGAGGATGAGGGAGGAGG + Intergenic
1092863228 12:12737668-12737690 GAAAGTGAGAAGGAGGGAGCTGG + Intronic
1093393589 12:18652970-18652992 CTAAGTGAGGATGAGGGAGCTGG + Intergenic
1094023652 12:25940643-25940665 GAAAGAGAGGGAGAGGGGGCCGG - Intergenic
1094190648 12:27694792-27694814 CAAATTGAGGTGGAGGTGGGCGG + Exonic
1094555755 12:31497924-31497946 CAAGGGCAGGGGGAGGGGGCGGG + Intronic
1095054346 12:37582050-37582072 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1095854170 12:46842380-46842402 CATAGTGTGGAGGAGGAGGAGGG + Intergenic
1096102928 12:48980320-48980342 CAAAGTGCGGAGTCGGGGGTGGG + Intronic
1096356872 12:50948852-50948874 CAGAGCGAGGAGGAGGGGGGAGG + Intergenic
1096580696 12:52582933-52582955 TACAGGAAGGAGGAGGGGGCAGG - Intergenic
1097236301 12:57542332-57542354 CATAGTGGGGAGGATGGGGGAGG - Intronic
1097243630 12:57592837-57592859 GCAGGTGGGGAGGAGGGGGCAGG + Intronic
1097282646 12:57854205-57854227 AAAACAGAGGAGGAGGGGGCGGG + Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1099946025 12:89245371-89245393 CAAAGTAAGGAAGTGGGGGAAGG - Intergenic
1099956088 12:89353635-89353657 CAAAGGGAGGAGGCGGCGGCAGG - Intergenic
1101348144 12:103905220-103905242 AAGAGAGAGGAGGAGGGGGATGG + Intergenic
1101723496 12:107371007-107371029 CAAAGGGAGGAGGAGAAGGGGGG - Intronic
1101987734 12:109460809-109460831 CAGAGGGAGGAGGCAGGGGCTGG + Intronic
1102009136 12:109607265-109607287 TAAAGCGAGGAGGCAGGGGCAGG + Intergenic
1102465450 12:113128182-113128204 CAAAAGGAGGTGCAGGGGGCTGG + Intronic
1102565496 12:113794811-113794833 CACAGTGGGGAGGGGGGGGGTGG - Intergenic
1102570146 12:113822554-113822576 CCAAGTGACGAGGATGGGGCAGG + Intronic
1102591393 12:113959226-113959248 GAGAGTGAGGAGGAGGGAGCCGG - Exonic
1103245353 12:119452017-119452039 CAAAGGGATGAGGAGAGGGGTGG + Intronic
1103475856 12:121218190-121218212 AAAAGTCAGGAGGAAGGGCCAGG + Intronic
1103482242 12:121258318-121258340 AAAAAGGTGGAGGAGGGGGCTGG - Intronic
1103485867 12:121282248-121282270 CAAAGTGGGGAAGGAGGGGCTGG + Intronic
1103518131 12:121520669-121520691 CCACGTGAGGAGGAAGAGGCAGG + Intronic
1103705861 12:122871924-122871946 GAAAGTGAGGTGGCGGCGGCTGG - Intronic
1104683229 12:130766909-130766931 CAAAGGGAGGAAGAGAGGGAAGG + Intergenic
1104799981 12:131547871-131547893 CAAAGCCAGGAGGAGTGGACGGG - Intergenic
1104858184 12:131911610-131911632 AAAAGTGAGGTGCAGAGGGCAGG + Intronic
1104918344 12:132277992-132278014 GGGAGTGAGGGGGAGGGGGCCGG - Intronic
1105204272 13:18207044-18207066 CACAGTGAGGTGGATGGGGTTGG + Intergenic
1105261401 13:18782348-18782370 TAAAGTGGGGAGGAGTAGGCTGG - Intergenic
1105347423 13:19586948-19586970 CAAAGTAAGGGGGAGGGGCACGG + Intergenic
1105500930 13:20971113-20971135 CAAAGTGTGCACGAGGGAGCTGG + Intergenic
1105879321 13:24590103-24590125 CGGAGTGAGGAGGGGGTGGCAGG - Intergenic
1105920514 13:24958955-24958977 CAGAGTGGGGAGGGGGTGGCAGG + Intergenic
1106013111 13:25843836-25843858 CATAGAGAGGAGGTAGGGGCTGG + Intronic
1107218917 13:37956216-37956238 CAAGGTGAGGAGGAGGGCAGTGG + Intergenic
1107409302 13:40143658-40143680 AAAAGTGAGGGTGAGGGAGCGGG + Intergenic
1107479829 13:40776849-40776871 CAAAGTAAGGGGGAGGGGCACGG + Intergenic
1107607883 13:42079672-42079694 CAAAGTTAGGAGGTGGTGGGAGG - Intronic
1107879702 13:44822299-44822321 AAAGAGGAGGAGGAGGGGGCGGG - Intergenic
1108105871 13:47008459-47008481 CAGAGGGAGGAGGAGGAGGAGGG + Intergenic
1108396633 13:49996897-49996919 GAAAGGGAGGGGGAGGGGGAGGG + Intronic
1108526859 13:51292913-51292935 CTAACTGAGGAGGAGGGCGGTGG + Intergenic
1108586533 13:51874848-51874870 CAAATTGTGGAGGAGGAGGGAGG - Intergenic
1108587651 13:51884573-51884595 CCAAGTCAGGTGGAGGGGTCAGG - Intergenic
1108770370 13:53693481-53693503 GAAAGAGAGGAGGAGGTGCCAGG - Intergenic
1112157690 13:96835285-96835307 CTCAGTGATGTGGAGGGGGCTGG - Exonic
1112323699 13:98429440-98429462 CACAGTGAAGTGGAAGGGGCTGG + Intronic
1112682974 13:101788172-101788194 AAAAAAGTGGAGGAGGGGGCAGG - Intronic
1113723660 13:112581084-112581106 CAATGTGGGGAGCAAGGGGCCGG - Intronic
1113743373 13:112725934-112725956 CAAGGTGCTGGGGAGGGGGCGGG + Intronic
1113796591 13:113061869-113061891 GAAGGGGAGGAGGAGGGGGAGGG - Intronic
1114259338 14:21025739-21025761 CAAGGCGGGGAGGTGGGGGCGGG + Intronic
1114454000 14:22843867-22843889 CAAGGTGAGAAGAAGTGGGCTGG + Exonic
1114557470 14:23570241-23570263 GAAAGTGCGGAGGTGGGGGTGGG + Intronic
1114712793 14:24795202-24795224 AAAAGTGAGGAGGAAGGGAAAGG + Intergenic
1115027828 14:28764585-28764607 AAAAGTGAGTAGGAAGGGGAAGG + Intergenic
1115301846 14:31893667-31893689 CTCAGTGAGGAGGAGGCGGGAGG + Intergenic
1116598755 14:46890120-46890142 GGAAGTGAGCAGGAGGTGGCTGG - Intronic
1117247148 14:53897442-53897464 CAAAATGAGGAGGAGAAGGGAGG + Intergenic
1117824814 14:59690291-59690313 CAAAGAGCGGAGGTGGGGGGGGG + Intronic
1118732617 14:68678996-68679018 CAATTTGAGGGGGTGGGGGCAGG - Intronic
1118771138 14:68943524-68943546 CAAGGTTGGGGGGAGGGGGCTGG - Intronic
1118836136 14:69479325-69479347 CAAAGTCAGGAGGTAGGAGCTGG + Intergenic
1119067392 14:71542610-71542632 GAAGGGGAGGAGGAGGGGGAGGG - Intronic
1119137181 14:72231827-72231849 GTAAGTGAGGAGGAGAGGGGTGG + Intronic
1119704028 14:76773061-76773083 GAATGTGAGAAGGAGGGGGCAGG - Intronic
1119853030 14:77879541-77879563 CAGAGGGAGGAGGGTGGGGCAGG + Intronic
1120201151 14:81539706-81539728 TAAAATGAGGAGGTCGGGGCAGG + Intergenic
1120218164 14:81703150-81703172 TAAAGTCAGGAGGAGGAGGGGGG + Intergenic
1120746170 14:88153838-88153860 CAAAGAGAGGAGGCAGGAGCAGG + Intergenic
1120887204 14:89461035-89461057 AAAAGGGGGGGGGAGGGGGCTGG + Intronic
1121234043 14:92379552-92379574 GCCAGAGAGGAGGAGGGGGCAGG - Intronic
1121472179 14:94164536-94164558 CCAAGTGAGGACTAGAGGGCGGG + Intronic
1121581507 14:95035643-95035665 CCAAGGAAGGAGGAGGAGGCTGG + Intergenic
1122317285 14:100833614-100833636 CAAAAAGAGGAGGAGGGTTCAGG - Intergenic
1122324265 14:100873363-100873385 CCATGGGTGGAGGAGGGGGCTGG - Intergenic
1122790651 14:104182918-104182940 CAGAGGGATGGGGAGGGGGCAGG - Intergenic
1122799403 14:104222127-104222149 CAAAGCGGGGAGGAGGGGCCTGG - Intergenic
1123222836 14:106872764-106872786 CGCAGGGAGGCGGAGGGGGCGGG - Intergenic
1123409082 15:20043826-20043848 GAAAGAGAGAAGGAGGGGGTGGG + Intergenic
1123518413 15:21050534-21050556 GAAAGAGAGAAGGAGGGGGTGGG + Intergenic
1123739889 15:23226193-23226215 CCAAGTGAGCAGGCTGGGGCAGG - Intergenic
1124291112 15:28455161-28455183 CCAAGTGAGCAGGCTGGGGCAGG - Intergenic
1124826432 15:33100506-33100528 GAAAGGGAGGAGGAGGGGAGGGG + Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125539642 15:40462559-40462581 CAAAGTGAGCAGGGAGGGGAGGG - Intronic
1125676159 15:41503591-41503613 GGAACTGAGGAAGAGGGGGCCGG - Intergenic
1126667039 15:51084722-51084744 AACAGTGAGGAGGAGGGGTCCGG + Intronic
1126994445 15:54424518-54424540 CAAATTGAGGAGAAGGGGAAAGG + Intronic
1127918089 15:63471908-63471930 GAAAGTGAGGAGGACGAGCCAGG + Intergenic
1128061930 15:64740827-64740849 CAAGGTGAGGAAGAGGAGGGAGG + Exonic
1128328641 15:66741484-66741506 TAAAATGAGGAGGAGGTGGGTGG + Intronic
1128496477 15:68201245-68201267 CAAAGTCAGGACCAGGTGGCAGG + Intronic
1128609596 15:69063227-69063249 TAAAATGAGGAGGTGGGGGCCGG + Intergenic
1128624138 15:69182082-69182104 AAAAGTGAGGATGAGAGGGAAGG + Intronic
1128732482 15:70030656-70030678 CAGAGGGAGAAGGAGGTGGCTGG - Intergenic
1128981855 15:72194015-72194037 GAAAGGAAGGAGGAGGGGGAGGG - Intronic
1129082265 15:73052013-73052035 CGAGGCGAGGAGGAGGAGGCGGG + Intronic
1129182124 15:73884251-73884273 CAAAGTGGGGTGGAGAGGGCTGG + Intronic
1129260990 15:74367264-74367286 GACAGGGAGGAGGAGGGGCCTGG - Intronic
1129483072 15:75843265-75843287 CAAGGCGAGGAGGGGGCGGCCGG + Exonic
1129697363 15:77748253-77748275 CAAGGTGGGGAGGAGGAGGACGG - Intronic
1129708254 15:77806864-77806886 CATAGTGTGGATGATGGGGCAGG - Intronic
1130648979 15:85751524-85751546 CAAACTGGGGTGGAGGGGGTAGG - Intergenic
1131403671 15:92146195-92146217 CAAAGGGAGGAGCAGGGGCTGGG - Intronic
1131972309 15:97904688-97904710 GAAAGAGAGGAGGAGGAGGAGGG + Intergenic
1132078622 15:98845463-98845485 AGGAGGGAGGAGGAGGGGGCAGG - Intronic
1132216039 15:100062307-100062329 CCAAGCTAGGAGGAGGTGGCAGG + Intronic
1132299916 15:100768963-100768985 TAAAGTGAAGAGGAAGGAGCTGG - Intergenic
1132302589 15:100785321-100785343 CAGAGTGAGGAGGAAGGGAAGGG + Intergenic
1132512887 16:352864-352886 TAAAGTGAGGAGCGTGGGGCGGG + Intergenic
1132638056 16:963020-963042 CCAAGTGAGGAGGAAGAGGGTGG + Intronic
1132847073 16:2005602-2005624 CAAAGTGGGGAGGTGGGGCTGGG - Intronic
1133032454 16:3017850-3017872 CCAGGTGAGGGGGAGGGGGGAGG + Intronic
1133388894 16:5393153-5393175 CAGAGAAAGGATGAGGGGGCAGG - Intergenic
1133460748 16:5984174-5984196 GAAGGAGAGGAGGAGGGGGAGGG - Intergenic
1134020534 16:10918408-10918430 CACAGTGAGGGGGAGGGCTCAGG - Intronic
1134089402 16:11383642-11383664 CACACTGTGGAGGAGGGGCCAGG + Exonic
1134667344 16:16028451-16028473 CAGAGAGAGGAGGAAGGGGTGGG - Intronic
1134842746 16:17414751-17414773 CACAGTGAGGAGGTGGTGGCAGG - Intronic
1135821740 16:25691945-25691967 GGAGGGGAGGAGGAGGGGGCCGG - Intergenic
1135879953 16:26245530-26245552 CATAGAGAGGAGAAGGAGGCTGG + Intergenic
1136080987 16:27852530-27852552 CAGAGGGAGGAGGAGGAGGGTGG + Intronic
1136233845 16:28902980-28903002 CACAGTGAGGAGGAAGGAGGTGG - Intronic
1136277945 16:29190662-29190684 CAAAGTGAGGAGGAAGGACAGGG + Intergenic
1136348698 16:29693553-29693575 TAAAATGAGGATGATGGGGCTGG - Intronic
1136510757 16:30737112-30737134 CAAGAGGAGGAGGAGGGGCCGGG + Exonic
1136541282 16:30928698-30928720 CAAGGTGAGCAGGAAGGGACAGG - Intronic
1136577960 16:31135391-31135413 GTAAGTGAGGACGTGGGGGCAGG - Intronic
1136632620 16:31497799-31497821 CAAAGTGAGGGCGAAGTGGCTGG + Intronic
1136707658 16:32202501-32202523 CCAAGTGAGCAGGCTGGGGCGGG + Intergenic
1136760252 16:32726909-32726931 CCAAGTGAGCAGGCTGGGGCGGG - Intergenic
1136778665 16:32884485-32884507 CAAAGTTAGGAGAAGGATGCTGG - Intergenic
1136799200 16:33055248-33055270 AAAAAGGAGGAGGAGGGGGAAGG - Intergenic
1136807852 16:33143477-33143499 CCAAGTGAGCAGGCTGGGGCGGG + Intergenic
1136891955 16:33977029-33977051 CAAAGTTAGGAGAAGGATGCTGG + Intergenic
1137264208 16:46855404-46855426 GAAAGTGAGTGGGAGGGGGATGG - Intergenic
1137581373 16:49635617-49635639 CAAGGAGAGGAGCAGGGAGCAGG + Intronic
1137603140 16:49769958-49769980 GGAGGTGAGGAGGAGAGGGCCGG - Intronic
1137731228 16:50691984-50692006 CCAAGGGAGAAGGAGGAGGCAGG - Intergenic
1137968355 16:52959102-52959124 AAAAAGGAGGAGGAGGGGGATGG - Intergenic
1138491232 16:57378024-57378046 CAGAGTGGGGCGGAAGGGGCAGG - Intronic
1138655996 16:58491754-58491776 AAAAGTGAAAAGGATGGGGCTGG - Intronic
1139120609 16:64011872-64011894 CAGAGAGAGGAGGAGGTGCCAGG - Intergenic
1139144780 16:64310096-64310118 AAAAGTGAGGAGGGGAAGGCAGG + Intergenic
1139297748 16:65917968-65917990 CCAAGTAAAGAGGAGGAGGCAGG + Intergenic
1139425006 16:66873904-66873926 AGAAGGGAGGAGGAGGGGGCAGG - Intergenic
1139636942 16:68263865-68263887 CAGAGGGAGGGGAAGGGGGCAGG + Intergenic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1139972615 16:70785672-70785694 CTCAGTGAGGAGGAGGAGGAGGG + Intronic
1140187768 16:72789645-72789667 GAAAGTGTGGAGGAAGGGCCTGG + Intronic
1140467146 16:75191596-75191618 CAAAATTAGGAGCAGGGGGAGGG + Intergenic
1140685077 16:77425744-77425766 CAAAAAGAGGAGGAGTGGGCCGG + Intronic
1141011420 16:80403813-80403835 GAAAGTGAGGATGAGGGGCTGGG + Intergenic
1141310873 16:82912155-82912177 AAGAGGGAGGAGGAGTGGGCTGG - Intronic
1141608553 16:85169163-85169185 TTAATTGGGGAGGAGGGGGCGGG - Intergenic
1141665712 16:85464123-85464145 CAGAGAGAGGAGGGGTGGGCGGG - Intergenic
1141774685 16:86115369-86115391 CAAGGTGAGGAGGGGAGAGCAGG + Intergenic
1141806200 16:86343292-86343314 CAAAGTGGGGAGGACTGAGCAGG - Intergenic
1142082319 16:88156702-88156724 CAAAGTGAGGAGGAAGGACAGGG + Intergenic
1142114095 16:88347516-88347538 CAAAGTGAAGATGGTGGGGCTGG - Intergenic
1142252650 16:88999715-88999737 CAGAGGGAGGAGGGGGGGGCGGG + Intergenic
1142304660 16:89278609-89278631 CCAAGGGAGGAGGTGGGGGAAGG + Intronic
1142379043 16:89721492-89721514 CAAAGCGAGGCGGGCGGGGCGGG - Intronic
1203062406 16_KI270728v1_random:987231-987253 CCAAGTGAGCAGGCTGGGGCGGG - Intergenic
1203081081 16_KI270728v1_random:1146579-1146601 CAAAGTTAGGAGAAGGATGCTGG - Intergenic
1142623386 17:1178845-1178867 CAAGGTGCGGTGGTGGGGGCGGG + Intronic
1142718751 17:1762694-1762716 CAAAGAGAGTGGGTGGGGGCTGG - Intronic
1142745835 17:1957543-1957565 CAAAGTGAGGTGGCAGGGCCGGG + Intronic
1143017009 17:3896271-3896293 AACAGTGGGGAGGAAGGGGCTGG - Intergenic
1143037439 17:4007427-4007449 CAGAGGGAGGAAGAGGGGGTTGG + Intronic
1143382132 17:6503161-6503183 CAGAGAGAGGAGGACGGGGATGG - Intronic
1143561973 17:7701806-7701828 CCAAGGGAGGAGGAGAGGGAAGG + Intronic
1145167238 17:20623858-20623880 CAGAGTGAGGAGTAGAGGCCAGG - Intergenic
1145285543 17:21503588-21503610 TAAAGAGAGAAGGAGGAGGCAGG + Intergenic
1145391984 17:22462149-22462171 TAAAGAGAGAAGGAGGAGGCAGG - Intergenic
1145709581 17:26958835-26958857 AAAAGTAAAGAGGAGGGGGAGGG - Intergenic
1145886917 17:28388273-28388295 CCAGGTGAGGAGGGGCGGGCGGG + Exonic
1146370367 17:32262347-32262369 CAAAGTGAGGATGGCCGGGCAGG - Intergenic
1147333414 17:39712303-39712325 CACACTGAGGAGGTGGGGGTGGG - Exonic
1147368410 17:39974598-39974620 CAAAGGGAGGAGCAGTGGCCTGG - Intronic
1147392540 17:40119256-40119278 CAAAGAGAGGAAGACTGGGCTGG + Intergenic
1147500069 17:40954556-40954578 CAAAGTGGGGTGGGGGGGGTTGG + Intergenic
1147741972 17:42675100-42675122 GGAAGGGAGGAGGAGGGGGAGGG - Intronic
1147760586 17:42795307-42795329 CAACGGGAGGGGGAAGGGGCAGG - Exonic
1147789855 17:43006969-43006991 GTAAGTGAGGAGGAGGGAGTTGG + Intronic
1147914566 17:43878776-43878798 CATAGGAAGGAGGATGGGGCTGG + Intronic
1148352371 17:46950301-46950323 GTAGGTGAGGAGGAGGCGGCTGG + Intronic
1148358903 17:46995872-46995894 CAGTGTAAGGAGGAGGGGCCTGG + Intronic
1148389164 17:47257909-47257931 CACAGTGAGGAGGGGGAGTCTGG + Intronic
1148455784 17:47810753-47810775 CAAGGTGAGGAGTAGAGGGCAGG - Exonic
1148799375 17:50213751-50213773 CTGGGTCAGGAGGAGGGGGCAGG - Intergenic
1148852322 17:50561177-50561199 CAAAGTGAGGGGGAGCCGGCCGG + Intronic
1149330546 17:55576874-55576896 CACAGAGAGTAGGAGGGAGCAGG + Intergenic
1149601916 17:57898804-57898826 CCAAGGGAGGAGCAGGGAGCTGG + Intronic
1149640655 17:58200325-58200347 GCAAGTGAGGAGGATTGGGCTGG + Exonic
1150176492 17:63062647-63062669 CAAAATGGGGAGGAGGGGGCTGG - Intronic
1151768200 17:76142932-76142954 CAAAGAGAAGAGGTGGGGCCTGG - Exonic
1152036599 17:77877141-77877163 CAAAGGGAGGAGGAGGTTGAGGG + Intergenic
1152677892 17:81651027-81651049 CACAGTGGGCAGGAGGGGGAGGG + Exonic
1153761521 18:8336602-8336624 AGAAGAGAGGAGGAGGGGGAGGG + Intronic
1153784563 18:8523175-8523197 CAGAGAGATGAGTAGGGGGCTGG - Intergenic
1154072248 18:11163144-11163166 CAATGAGAGGAGGAGGGGGAGGG - Intergenic
1154518680 18:15201921-15201943 AAAAGTAAAGAGGAGGGGGAGGG + Intergenic
1155035630 18:22022661-22022683 CAGAGTGAGGGGGAGAGGGGTGG + Intergenic
1155191895 18:23437762-23437784 CAAGGTGAGGGGGCGGGCGCGGG - Exonic
1155197222 18:23486443-23486465 CAAAATCAGGAGGAGAAGGCTGG + Intronic
1155325309 18:24658511-24658533 GATGGAGAGGAGGAGGGGGCTGG + Intergenic
1157453955 18:47809722-47809744 CAAAGAGAGGGTCAGGGGGCGGG - Exonic
1158182346 18:54730660-54730682 GAGAGTGAGGAGGAGGAGTCAGG - Intronic
1158311597 18:56165548-56165570 GAAAGAGAGGAGGAGGTGCCAGG + Intergenic
1158599605 18:58846082-58846104 CAAAGGGAGGAGGAAGGAGAGGG + Intergenic
1159060618 18:63510498-63510520 CAAAGTTGGGGGGAGGGGGGCGG - Intergenic
1159711750 18:71768034-71768056 CAAAGAGAGGAGGATGGTGAAGG + Intronic
1160225871 18:77010031-77010053 CAGAGTGAGGAGGAGTGAGCGGG + Intronic
1160448599 18:78946890-78946912 AAAAGGGAGGAGGAGGAGGATGG + Intergenic
1160513669 18:79466712-79466734 CCAACTGAGGAAGAGGAGGCAGG - Intronic
1160785191 19:897110-897132 TCAAGTGAGGAGGGGGAGGCTGG - Exonic
1160791888 19:927044-927066 CGAAGGGAAGAGGAGGGGGAGGG - Intronic
1161103973 19:2434244-2434266 CAGAGTGAGGAGGAGGGGCAGGG - Intronic
1161257307 19:3316511-3316533 GAAAGGGAGGAGGAGAGGGCAGG + Intergenic
1161270307 19:3386000-3386022 CAGAATGAGGAGGATGGGCCGGG - Intronic
1161300023 19:3538025-3538047 CAGAGTGAGGAGAGGAGGGCAGG + Intronic
1161314005 19:3609403-3609425 GAACGTGAGGAGGAGGAAGCAGG + Intergenic
1161328144 19:3673127-3673149 CAGAGGGAGGAGCAGAGGGCAGG - Intronic
1161331987 19:3692826-3692848 AACAGTGAGGAGGGGAGGGCAGG - Intronic
1161332889 19:3696724-3696746 CAGAGTGCGGAGGGGAGGGCAGG + Intronic
1161345954 19:3768814-3768836 CAGAGTGAGGAGGGGGAGGAGGG - Intergenic
1161370549 19:3908690-3908712 AAAAGGGAGGAGGAGGGGGGAGG - Intronic
1161403856 19:4081077-4081099 AAAAGAGGGGAGGAGGGGGCCGG + Intergenic
1161449767 19:4338628-4338650 TAAGGTGGGGAGGCGGGGGCTGG - Intronic
1161522233 19:4731029-4731051 GAAAGGGAAGAGGAGAGGGCAGG - Intergenic
1161623200 19:5310055-5310077 CAGAGTGAGGAGGGGGAGGAGGG - Intronic
1161719750 19:5896227-5896249 CAGAGTGAGGAGGGGAGGGTGGG + Intronic
1161756428 19:6137456-6137478 CAGAGTGAGGAGGGGGAGGGAGG + Intronic
1161821672 19:6533884-6533906 CAAAGGGAGCAGGAAGGGGTGGG - Intronic
1161969609 19:7570076-7570098 CAAAGTGAGATGGCGGAGGCGGG + Intergenic
1161984933 19:7647819-7647841 GAAAGGGAGGGGTAGGGGGCGGG - Exonic
1162024196 19:7884528-7884550 GAGAGGGAGGAGGAGGGGGAGGG + Intergenic
1162300403 19:9841821-9841843 AAGAGTGAGCAGGAGGGTGCAGG + Intronic
1162604705 19:11697676-11697698 CAAAGGGAGGAGAATGGAGCTGG - Intergenic
1162959928 19:14119625-14119647 CACAGAGAGGGGGAGCGGGCTGG + Exonic
1162968346 19:14166233-14166255 AAAAATGAGGGCGAGGGGGCGGG - Intronic
1163154710 19:15433369-15433391 CTAAGTGGGCAGGAGGGGGCGGG - Intronic
1163169036 19:15517959-15517981 GCAAGTGAGGAGGAGGGTGGTGG + Intronic
1163218119 19:15895546-15895568 CAAACTGAGGAGGGGGGAGATGG + Exonic
1163560188 19:18014395-18014417 GAGAGTGGGGAGCAGGGGGCTGG + Intergenic
1163610547 19:18299151-18299173 CAAAGTGAGGGCGAGGGAGCAGG - Intergenic
1163755768 19:19105460-19105482 CAAAGTGCGGAGGCGGGGCCGGG - Intronic
1163776939 19:19224455-19224477 CAAAGAGAGGCGGAGGGGCCGGG - Intronic
1164157083 19:22603451-22603473 CAAAGCCAGGAGAAGGGGGGTGG + Intergenic
1164512005 19:28905078-28905100 CTGAGTGAGGAGCAGGGAGCTGG - Intergenic
1164556435 19:29256190-29256212 CAAAGGGAGGAGGACGGGAAGGG + Intergenic
1164670610 19:30070145-30070167 CCAAGCTGGGAGGAGGGGGCCGG - Intergenic
1164674817 19:30094167-30094189 CAATGGCAGGAGGTGGGGGCAGG - Intergenic
1165094348 19:33402344-33402366 GAAGCAGAGGAGGAGGGGGCTGG + Intronic
1165097270 19:33416521-33416543 CCAGGTGAGCAGGAGGGAGCAGG - Intronic
1165313499 19:35041703-35041725 TCACCTGAGGAGGAGGGGGCTGG - Exonic
1165350969 19:35275340-35275362 CAAAGTGAGTAGAAGGGGCCGGG - Intronic
1165573026 19:36791484-36791506 CAAATTACGGAGGAGGGGGCAGG - Intergenic
1165632347 19:37312502-37312524 CAAATTATGGAGGAGGGGGCAGG - Intergenic
1166093525 19:40525528-40525550 CAAAACGAGGAGGAGGAGCCCGG + Intronic
1166301233 19:41913155-41913177 CCGAGTGAGGAGGAGGCTGCGGG - Intronic
1166366088 19:42279265-42279287 CAGAGGGATGAGGAGGGAGCTGG - Intronic
1166500820 19:43339952-43339974 CAAAGGGTGGTGGAGAGGGCTGG - Intergenic
1166853178 19:45769935-45769957 GCAAGTGAGGAGGGGGGCGCGGG + Exonic
1167192855 19:48003840-48003862 TAAAGTGAGGAGGAGTGGGCCGG - Intronic
1167354267 19:48993555-48993577 CAAAGTGGGGAGGAGGAGGAGGG + Exonic
1167439710 19:49500986-49501008 CAAAGAGGGCAGGAAGGGGCAGG + Intergenic
1167488913 19:49780712-49780734 TCAAGTTAGGAGGAGGTGGCTGG + Intronic
1167593140 19:50415105-50415127 GGATCTGAGGAGGAGGGGGCTGG - Intronic
1167648254 19:50717212-50717234 CAAAGTGGGGCGCAGGGGGCGGG - Intronic
1167669101 19:50839336-50839358 GAAAGGGAAGAGGAGGGAGCTGG - Intergenic
1167765323 19:51478753-51478775 CAAAGCGGCGGGGAGGGGGCTGG + Intronic
1167786717 19:51643605-51643627 CAGGGTGAGGACGAGGGGCCAGG + Exonic
1167792626 19:51690936-51690958 CAAGGTGGGGAGGAAGGGGAAGG - Intergenic
1168125476 19:54280220-54280242 CCCAGTGAGGAGGAGGGACCTGG + Intronic
1168169003 19:54574133-54574155 CCTAGTGAGGAGGAGGGACCTGG - Intronic
1168171778 19:54594498-54594520 CCCAGTGAGGAGGAGGGACCTGG - Intronic
1168176499 19:54631328-54631350 CCCAGTGAGGAGGAGGGACCTGG - Intronic
1168181092 19:54663589-54663611 CCCAGTGAGGAGGAGGGACCTGG - Intronic
1168185323 19:54696661-54696683 CAGGGTGAGGAGGAGGGACCTGG - Intronic
1168510138 19:56967299-56967321 GAAAATGAGGAGGAGGGGAAGGG - Intergenic
1202682847 1_KI270712v1_random:25123-25145 AAAAGTAAAGAGGAGGGGGAAGG - Intergenic
1202697534 1_KI270712v1_random:135841-135863 AAGAGGGAGGAGGAGGGGGAAGG - Intergenic
925822728 2:7816211-7816233 CAAAGTCTGGAGGCTGGGGCTGG + Intergenic
926434386 2:12823733-12823755 CCAACAGAGTAGGAGGGGGCTGG - Intergenic
926712312 2:15891273-15891295 CCATGTGCAGAGGAGGGGGCAGG + Intergenic
926732616 2:16048462-16048484 CAAATTGAGGAGGTGGGAGTAGG + Intergenic
927135020 2:20090757-20090779 CGAAGTGTGGAGGAGGAGGAGGG - Intergenic
927344499 2:22022138-22022160 GAAAGTGTGGAGAATGGGGCTGG - Intergenic
927445735 2:23159895-23159917 CAAAGAGAGGAACAGTGGGCTGG + Intergenic
927837071 2:26407653-26407675 AAACATGAGGAGGAGGGTGCCGG - Intronic
928398942 2:30964342-30964364 CACAGGGAGGTGGAGGTGGCTGG - Intronic
928461467 2:31477137-31477159 CACAGTGATGAGGAAGGGGATGG + Intergenic
928955695 2:36865008-36865030 AAAATTGAGGAGGAGGGGCCGGG - Intronic
929276785 2:40034421-40034443 TAAAGAGGGGAGGAGTGGGCAGG + Intergenic
929859070 2:45660253-45660275 AGAAGTGAGGAGGAGGAGGAAGG + Intronic
929948586 2:46389098-46389120 GGAAGTGAGGAGCAGGAGGCTGG - Intergenic
930000088 2:46855545-46855567 CATGATGAAGAGGAGGGGGCAGG + Intronic
930615226 2:53586832-53586854 CACAGTGAGGAAGAGGAGGAAGG + Intronic
931036725 2:58252035-58252057 CACAGTGAGGTGGATGGGGTTGG - Intergenic
931259548 2:60605250-60605272 CCATAGGAGGAGGAGGGGGCTGG - Intergenic
931662962 2:64585786-64585808 CAAAGTGAGGTGGGGGGGCAGGG - Intronic
931665130 2:64605060-64605082 CAAAGTCTGGTGGAGAGGGCGGG - Intergenic
932067665 2:68583672-68583694 CAAAAGGAAGAGGAGGGGGTTGG - Intronic
932387669 2:71352178-71352200 TATAAAGAGGAGGAGGGGGCCGG + Intronic
932406768 2:71518117-71518139 ACAAGTGAGGAGGCTGGGGCAGG - Intronic
932628455 2:73317968-73317990 GAAAGAGAGGAGGAGAGGGGAGG - Intergenic
932729428 2:74207904-74207926 GAGAGGGAGGAGGAGGGGGATGG - Intronic
933071067 2:77858238-77858260 CAATGTTAGGAGGTGGGGTCTGG + Intergenic
933702973 2:85268983-85269005 CAAAGTGAGGAAGAAGGTGGAGG + Intronic
934158768 2:89228288-89228310 CAAACTCAGGTGGAGGTGGCTGG - Intergenic
934208507 2:89954140-89954162 CAAACTCAGGTGGAGGTGGCTGG + Intergenic
934248953 2:90330051-90330073 AAAAGTAAAGAGGAGGGGGAAGG + Intergenic
934260626 2:91473425-91473447 AAAAGTAAAGAGGAGGGGGAAGG - Intergenic
934278706 2:91592865-91592887 AAGAGGGAGGAGGAGGGGGAAGG - Intergenic
934516165 2:94988132-94988154 CAATGTGAGGAGGTGGTGGTGGG - Intergenic
934574769 2:95392925-95392947 CAGGATGAGGAGGAAGGGGCTGG + Intergenic
934579388 2:95426447-95426469 AGAAGTGAGGGGGAGGGGGTGGG + Intergenic
934600055 2:95650277-95650299 AGAAGTGAGGGGGAGGGGGTGGG - Intergenic
935620229 2:105123554-105123576 TAAAATAAGGAAGAGGGGGCTGG + Intergenic
935735723 2:106105376-106105398 GAAAGTGATGCGGAGGTGGCAGG + Intronic
937147942 2:119663439-119663461 CATGGTGAGGAGGAAGGGGAGGG - Intergenic
937264188 2:120605823-120605845 CAGAGTGAGGTGGAAGGGGGTGG + Intergenic
937291423 2:120784487-120784509 GCAAGTGAGGCTGAGGGGGCAGG + Intronic
937827071 2:126378777-126378799 CAAAGAGTGGAGGAGGGTGAAGG - Intergenic
937953746 2:127407999-127408021 CAGGGGGAAGAGGAGGGGGCGGG - Intergenic
938518674 2:132042416-132042438 AAAAAGGAGGAGGAGGGGGAGGG + Intergenic
938698753 2:133857962-133857984 AAAGGTGGGGAGGAGGGGGAGGG - Intergenic
939275454 2:139992111-139992133 CTTAGTGAGGAGGAGGGGGTGGG + Intergenic
941790407 2:169546625-169546647 CCAAGTGAGGAGAAGGGAGCAGG + Exonic
941916435 2:170816820-170816842 CAGAGTGGGGAGGCGGGGACCGG - Exonic
942044824 2:172094445-172094467 AAAAGAAAGGAGGAGGTGGCAGG - Intergenic
942507355 2:176657065-176657087 GAAAGGGAGGAGGAGGAGGGAGG + Intergenic
942572042 2:177324509-177324531 CAAAATGAAGAGGAGGGGGTGGG - Intronic
943278257 2:185896820-185896842 AAAAGGGAGGGGGAGGGGGAGGG + Intergenic
943830704 2:192458209-192458231 GAAATTGAGGAGCAGGGGGAGGG - Intergenic
944217838 2:197273600-197273622 AAAAGAGAGGAAGAGGGCGCAGG + Intronic
944574432 2:201078004-201078026 AGAAGTTAGGAGCAGGGGGCCGG + Intronic
945032220 2:205676481-205676503 CACACTGATGGGGAGGGGGCTGG - Intergenic
945259640 2:207831729-207831751 CACTGGAAGGAGGAGGGGGCTGG - Intronic
945538706 2:211055149-211055171 GAGAGGGAGGAGGAGGGGGAGGG + Intergenic
945726491 2:213476718-213476740 CTCAGTGAGCAGGAGGGAGCGGG + Intronic
946059864 2:216932765-216932787 CACAGCTAGGAGGAGGGGTCAGG - Intergenic
946366798 2:219253693-219253715 CAAAGTCACCAGGAGGGGGTTGG + Intronic
946559144 2:220892805-220892827 CAAAGTGAAGAATTGGGGGCTGG - Intergenic
946683184 2:222239339-222239361 CAGAGAGAGAAGGAGGGGGGAGG + Intronic
946909259 2:224443723-224443745 CAGAGGGAGGAGGATGGGGTAGG - Intergenic
946945754 2:224820359-224820381 CAAAGTGTGGAGCAGGAGGAAGG + Intronic
947011064 2:225567600-225567622 CAAAGTGAGGGGCAGAGGGTGGG + Intronic
947045561 2:225978932-225978954 CAAAGTGAGGAAGCAGGGCCTGG - Intergenic
947220718 2:227789479-227789501 GAAAGAGAGGAGGAGGAGGAAGG - Intergenic
947541995 2:230986027-230986049 CAAGGTGAGGAAGAGGTGGGAGG + Intergenic
947636945 2:231684981-231685003 CACAGCGAGGAGGAGGAGGATGG + Intergenic
947819682 2:233061219-233061241 CAAATTGAGGGGGTGGGGGGTGG - Intronic
948242544 2:236449509-236449531 CACAGTCCGGAGGCGGGGGCTGG + Intronic
948295483 2:236857243-236857265 GAGAGTTAAGAGGAGGGGGCGGG - Intergenic
948606778 2:239140929-239140951 CACAGTGAGGAGGATGAGGAGGG + Intronic
948615174 2:239193732-239193754 CAAAGTGGGGAAGGCGGGGCAGG + Intronic
948705536 2:239790014-239790036 CAAAGTGAGAAAGTGGGGGTGGG - Intronic
948853666 2:240720214-240720236 CACAGGGTGGAGGTGGGGGCAGG - Intronic
949032247 2:241802637-241802659 CAGAGGGAGGAGGAGGGGCCGGG + Intronic
1168995486 20:2129807-2129829 CAAGCAGAGGAGGAGGGAGCCGG + Intronic
1169043487 20:2516561-2516583 CAGAGTGAGGATGAGTGAGCAGG + Intronic
1169093962 20:2879458-2879480 CATGGTGAGCAGGAAGGGGCAGG + Intronic
1169216945 20:3799644-3799666 CTAAGGCAGGAGGAGGGGGTGGG + Intronic
1170809721 20:19664484-19664506 CAAAATGAGGATGAGGAGGAAGG - Intronic
1171088470 20:22261849-22261871 CAGAGAGAGGGGGAGGGCGCTGG - Intergenic
1171317137 20:24205287-24205309 GAAAGAGAGGAGCAGAGGGCAGG + Intergenic
1171527913 20:25830297-25830319 CAAATTATGGAGGAGGGGGCAGG - Intronic
1171548913 20:26025583-26025605 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1172702304 20:36861218-36861240 GAAGGTGAGGAGGAGGAGGGAGG - Intronic
1173037639 20:39428072-39428094 GAAAGGGAGGGGGAGGGGGAGGG - Intergenic
1173207875 20:41008628-41008650 GAATGTGAGAAGGAGGGGGTGGG - Intergenic
1173248262 20:41350686-41350708 CCAAGTGAGGAGCAGGGGAAGGG + Intronic
1173547996 20:43914340-43914362 CAGTGAGACGAGGAGGGGGCGGG + Intergenic
1173564080 20:44026906-44026928 CAAGGTGGGGAGGAGGCGGCAGG - Intronic
1173687910 20:44937013-44937035 CAAAGGGAGGAGTAGGGGTATGG + Intronic
1174274884 20:49396461-49396483 CAAAGTGAGGAGGCTGTGGTAGG + Intronic
1174292566 20:49519490-49519512 AAGGGTGAGGAGGAGGGGCCAGG - Intronic
1174455780 20:50647776-50647798 CATAGTGAGAATGAGGTGGCCGG - Intronic
1174512352 20:51063478-51063500 TAAAGTGAGGAGGAGGGATGGGG - Intergenic
1174581702 20:51576855-51576877 CAGACTGGGGAGGAGGGGCCTGG + Intergenic
1174882522 20:54296116-54296138 AAAAGTGAGTAGGAAGTGGCAGG - Intergenic
1175254033 20:57628120-57628142 GATGGTGAGGGGGAGGGGGCAGG + Intergenic
1175690366 20:61061208-61061230 CTAAGTGAAGAGGAAGGGGTGGG - Intergenic
1175734195 20:61373929-61373951 GAAAGTGATGGGGATGGGGCAGG + Intronic
1175759122 20:61549479-61549501 CAAAGGGAGGTTTAGGGGGCAGG + Intronic
1175871381 20:62211001-62211023 AAAAGAGAGGAGCAGGGGGTGGG - Intergenic
1175901825 20:62362973-62362995 CAAAGGGAGCAAGAAGGGGCAGG + Intronic
1176048187 20:63103289-63103311 GGAAGTGGGGAGGAGGGAGCGGG + Intergenic
1176070974 20:63226333-63226355 CAAGCTGAGGAGGAGGGGACCGG + Intergenic
1176154365 20:63610822-63610844 CAAAGTCAAGTGGAGGGGGTGGG - Intronic
1176362063 21:6006180-6006202 CAAAAGGAGGAGGAGGAGGGGGG + Intergenic
1176513682 21:7767407-7767429 GAGAGGGAGGGGGAGGGGGCAGG - Intronic
1176713705 21:10331041-10331063 CACAGTGAGGTGGATGGGGTTGG - Intergenic
1176847465 21:13887629-13887651 TAAAGTGGGGAGGAGTAGGCTGG - Intergenic
1178647795 21:34397931-34397953 GAGAGGGAGGGGGAGGGGGCAGG - Intronic
1179613369 21:42566353-42566375 CAAAGCTGGGAGGAGGTGGCTGG - Intronic
1179633442 21:42692634-42692656 CCCAGTGAGGAGGACGAGGCTGG + Intronic
1179761455 21:43532365-43532387 CAAAAGGAGGAGGAGGAGGGGGG - Intronic
1180000647 21:44993886-44993908 CACAGGTAGGAGGACGGGGCAGG - Intergenic
1180534273 22:16383077-16383099 AAAAAGGAGGAGGAGGGGGAGGG - Intergenic
1180967463 22:19798099-19798121 CCAAGTGGGGAGGTAGGGGCTGG - Intronic
1181423347 22:22817258-22817280 GTAAGTGAGGAGCTGGGGGCAGG - Intronic
1181887209 22:26030797-26030819 CCAAGTGAAGAGGAGGAGGAAGG - Exonic
1181887338 22:26031734-26031756 GCAAGGGAGGAGGATGGGGCAGG + Intergenic
1182057300 22:27369661-27369683 CAGAGTGAGGGGGAGGAGGAGGG + Intergenic
1182122838 22:27798338-27798360 CAAAGTCCGGCGGCGGGGGCCGG + Exonic
1182877468 22:33704694-33704716 GTAAGTGAGAAGGAGGAGGCCGG - Intronic
1183061737 22:35340372-35340394 CTAAGTGAGGTGGAGGCCGCGGG + Intronic
1183357312 22:37366699-37366721 CCAAGGGAGGAGGAGGAGGACGG - Intergenic
1183455177 22:37918675-37918697 AAAGGGGAGGAGGAGGGGGCAGG + Intronic
1183539685 22:38422912-38422934 CGAAGTGGGGAAGAGAGGGCAGG + Intergenic
1183546659 22:38457760-38457782 CAGGGAGAGGAGGAAGGGGCAGG + Intergenic
1183649471 22:39145711-39145733 CAAACCGAGGGGGCGGGGGCGGG + Intronic
1183732282 22:39625310-39625332 CAAAGCCATGAGGAGTGGGCTGG + Intronic
1184098410 22:42329012-42329034 CAGAGTGAGGTGGAGGGTGCTGG - Intronic
1184454641 22:44602533-44602555 CAAAGTGATGTGGGGGGGGGGGG - Intergenic
1184533203 22:45070118-45070140 CAATGTGGGGAGGATGGGGCGGG + Intergenic
1184720441 22:46309491-46309513 CACAGAGAGGAAGACGGGGCGGG + Intronic
1184797012 22:46738389-46738411 AAGAGGGAGGAGGAAGGGGCCGG + Intergenic
1185090068 22:48761532-48761554 GAAGGTGAGGACGATGGGGCAGG + Intronic
1203289236 22_KI270735v1_random:17720-17742 CAAAGAGACGAGGCGGCGGCAGG + Intergenic
1203315370 22_KI270737v1_random:2719-2741 AAAAAGGAGGAGGAGGGGGAGGG + Intergenic
950122150 3:10489003-10489025 GAAAGTGAGGAGGCAGGGGTAGG - Intronic
950191278 3:10978105-10978127 CAGAGAGAGGAAGAGGGCGCAGG - Intergenic
950270529 3:11611128-11611150 AGAAGAGAGGGGGAGGGGGCGGG + Intronic
950274071 3:11643376-11643398 CACACTGAGGAGGAGTGGCCGGG + Intronic
950674459 3:14546193-14546215 CAAAGGGAGGAGGAGGTTCCAGG + Intergenic
950895807 3:16449842-16449864 GGATGTGAGGAGGAAGGGGCAGG + Intronic
951922893 3:27875320-27875342 CTATTTGGGGAGGAGGGGGCAGG - Intergenic
952010648 3:28897164-28897186 GAAAGAGAGGAGGAGGTGCCAGG + Intergenic
953336405 3:42098087-42098109 CAGGGTGAGGAGGAGGGGAGGGG - Intronic
953448470 3:42987301-42987323 CAAAGTGGAGAGGAAGGGGAAGG + Intronic
953592216 3:44269364-44269386 GAAAGTGAGGAAGAGGAGGGAGG - Intronic
953601964 3:44375415-44375437 AAAAGAGAGGAGGAGGCGCCAGG + Intronic
953929047 3:46996898-46996920 CAGAGGGAGGAGGGGGTGGCAGG - Intronic
954142657 3:48617342-48617364 CCAAGTGAGGGGAAGTGGGCTGG - Intergenic
954217545 3:49132912-49132934 CAAAGCAAGGAGGAGGGCTCGGG - Intronic
954251495 3:49371096-49371118 CACCGTGGGGTGGAGGGGGCCGG - Intronic
954368131 3:50156749-50156771 GGAAGTGGGGAGGTGGGGGCCGG + Intronic
954619715 3:51988634-51988656 GAAGGAGAGGAGTAGGGGGCTGG - Intronic
954932391 3:54295541-54295563 CAAAGTGAGGAGGAGGCTTCCGG + Intronic
955683064 3:61522566-61522588 CACACTGTGGAGGAGGGGGAAGG + Intergenic
955745936 3:62140549-62140571 AACAGTGGGGAGGAGGGGCCGGG + Intronic
956086557 3:65617304-65617326 AAAAGTGAGGAGGAATGGGAGGG + Intronic
957376569 3:79366434-79366456 CAAAGTCAGAAAGAGGAGGCTGG - Intronic
957616774 3:82539176-82539198 GAGAGAGAGGAGGAGGGGTCAGG - Intergenic
957730608 3:84128855-84128877 CAAAGGGAGGAGCGGGGGACAGG - Intergenic
959395954 3:105838516-105838538 GAAAGGGAGGAGAAAGGGGCAGG + Intronic
960051360 3:113241915-113241937 AGAAGGGAGGAGGAGGAGGCTGG + Intronic
960096709 3:113696547-113696569 CAAAAAGAGGCGGCGGGGGCGGG - Exonic
960964851 3:123097686-123097708 AAAATGGAGGGGGAGGGGGCGGG - Intronic
961329951 3:126132500-126132522 CGATGTGAGGAGGAGGAGGGAGG - Intronic
961330678 3:126136117-126136139 CAAAGGGAGAGGGAGGGGGTAGG - Intronic
961553965 3:127685122-127685144 AAAGGTGAGCAGGAGCGGGCCGG - Intergenic
961644716 3:128386753-128386775 GAGAGTGAGGAGGAGGTGCCAGG + Intronic
961921169 3:130428051-130428073 CAAAGGTAGGTGGAAGGGGCTGG + Intronic
962278102 3:134030558-134030580 CAAGGTGAAAAGGTGGGGGCTGG + Intronic
962308575 3:134310209-134310231 AAAAGGGAGGAGGAAGGGGGTGG + Intergenic
962701136 3:138000649-138000671 CAAAGTGAGAAGGAGGGACTGGG + Intronic
962960537 3:140307333-140307355 CAAGGAGAGCAGGAGGAGGCCGG - Intronic
963108240 3:141664609-141664631 CAAAGTGAAGAGTTGGGGCCTGG - Intergenic
964527353 3:157629749-157629771 CAGGGTGTGGAGGAGGAGGCAGG + Intronic
964667620 3:159191305-159191327 GAAGATGAGGAGGAGGAGGCTGG + Intronic
964794248 3:160480523-160480545 AAAAGTGGGGAGGAGGCGGTGGG - Intronic
965545219 3:169908896-169908918 CACAGTGCGGAGGAGTGGGAGGG - Intergenic
965726441 3:171721433-171721455 CCAACTGAGGAGGATGGGGCTGG + Intronic
966026214 3:175286288-175286310 AAAAAGGAGGAGGAGGAGGCTGG + Intronic
966205845 3:177405540-177405562 CAAAGTGAGGATGGGTGAGCGGG + Intergenic
966269274 3:178085063-178085085 GCAAGAGAGGAGGAGGGGGGAGG + Intergenic
966924442 3:184635242-184635264 AAGAGGGAGGAGGAGGGGACGGG + Intronic
966948566 3:184795653-184795675 GACAGTGAGGGGGAGGGGGAGGG - Intergenic
967087488 3:186108525-186108547 CGCAGTTGGGAGGAGGGGGCGGG - Intronic
967381434 3:188863516-188863538 CAGTGTCAGGAGGAGGGGGCTGG - Intronic
967397587 3:189024491-189024513 CCCAGTGAGGAGGAGTGGACTGG + Intronic
967922741 3:194625011-194625033 AAAAGAGGGGATGAGGGGGCCGG - Intronic
968078175 3:195828304-195828326 CCAACTGAGGAGGAGGAGGAGGG + Intergenic
968186375 3:196635710-196635732 CAAAGAAAGGAGGAGGAGGCCGG - Intergenic
968551620 4:1226343-1226365 CCTGGGGAGGAGGAGGGGGCAGG + Intronic
968578150 4:1377439-1377461 CAGTGTGAGGAGGGAGGGGCTGG + Intronic
968663856 4:1810261-1810283 CACGCTGAGGAGGAGGGGGCTGG - Intergenic
969088849 4:4677336-4677358 GAAGGTAAGGAGGAGGGGGAAGG - Intergenic
969097368 4:4743793-4743815 CAAAGTGAGAAGGAAGGAGCTGG + Intergenic
969508520 4:7603174-7603196 GAAAGAGAGGGGGAGGGGGAGGG + Intronic
969518458 4:7661851-7661873 CTAAGTGTGGAGGTGGGGGGCGG + Intronic
969625724 4:8304377-8304399 CAAAGTGACCGGGAAGGGGCAGG + Intronic
971076504 4:23155110-23155132 GAAAGTGAAGAGGAAGGGGAAGG + Intergenic
971221091 4:24706542-24706564 CACAGGGAGGAAGAGGGAGCTGG - Intergenic
971268221 4:25113248-25113270 CAACTGGAGGAGGTGGGGGCGGG + Intergenic
972351998 4:38244559-38244581 CAAGGGAAGGAGGAGGGGGCCGG - Intergenic
972633987 4:40866484-40866506 CAAAGTGAGGAGGAAGAGGGAGG - Intronic
973901060 4:55472162-55472184 CAAAGTGAAGAGGAGAGGAATGG + Intronic
974032009 4:56784557-56784579 TAAAAAGAGGAGGAGAGGGCCGG + Intergenic
974935250 4:68403759-68403781 CAAAGTGCTGAGGCGGGTGCTGG - Intergenic
976132830 4:81903382-81903404 GAGAGTGAGGAGGAGAGGGCTGG - Intronic
976973094 4:91133211-91133233 GAAAGGGAAGAGGAGGGGGTAGG - Intronic
977295721 4:95206703-95206725 CATAGTGAGGACGACTGGGCGGG + Exonic
977558319 4:98506874-98506896 AAAAGCTGGGAGGAGGGGGCGGG + Intronic
977677046 4:99759324-99759346 AAAAGCGATGAGGAGGGGGTGGG - Intergenic
978243894 4:106549209-106549231 CACTTTGAGGAGGAGGAGGCAGG - Intergenic
980129314 4:128803603-128803625 CCAGGTGAGGAGGAGGAGGATGG - Intergenic
981701972 4:147617301-147617323 CAAAGTGAGTCGGATGGGGCGGG + Intergenic
981839676 4:149096398-149096420 CAAAGAGAAGAGGAGGAGTCTGG - Intergenic
982806549 4:159772618-159772640 AAAAGGGAGGAGAAGGGAGCAGG - Intergenic
982871889 4:160590042-160590064 GAAAGAGAGGAGGAGGTGCCAGG + Intergenic
983647895 4:170010512-170010534 TAGACTGAGGAGGAGGGGGAGGG - Intronic
984148793 4:176099735-176099757 CAAAGTGTGAAGGAGTGGGAGGG - Intronic
984994957 4:185421509-185421531 AAAAGAGAGGAGGAGGTGCCAGG - Intronic
985238236 4:187900545-187900567 CAAACTGAGAAGGAGAGGCCAGG + Intergenic
985445300 4:190018364-190018386 AAAAGAGAGGATGAGGGAGCTGG - Intergenic
985657006 5:1137526-1137548 CAGGTTGAGGAGGAGGGGGAAGG - Intergenic
986429193 5:7664979-7665001 CAAAGTGAGGAGGAGGGGGCGGG - Intronic
986740300 5:10699951-10699973 CAAAGTGAGGAGGCAGATGCTGG + Intronic
987647965 5:20700442-20700464 CAAGGTGAGGTGGAGGAAGCAGG - Intergenic
988359537 5:30217883-30217905 TAAAGTGAGGAGGAGAGGGTGGG - Intergenic
988748371 5:34168418-34168440 CAAGGTGAGGTGGAGGAAGCAGG + Intergenic
989546792 5:42683652-42683674 GAAAGAGAGAAGGAGGGTGCAGG + Intronic
989627785 5:43448224-43448246 CAAAATGTGGAGGAGAAGGCAGG - Intronic
989807255 5:45624676-45624698 GAAAGTGTGAAGGATGGGGCTGG + Intronic
991630378 5:68650610-68650632 CAAAGTGAGGAAGAAGTGGCTGG - Intergenic
991650286 5:68845635-68845657 CAAAGCAAGGAGGAGAGGGAAGG + Intergenic
992199326 5:74368328-74368350 GAAAAGGAGGAGGAGGAGGCAGG + Intergenic
993139177 5:84008703-84008725 AAAAGTGAGTAGGAGGTGGGAGG + Intronic
993985613 5:94593878-94593900 CCAAATGAGGAGAAGGGAGCAGG - Intronic
994165633 5:96605232-96605254 TAAAGTGATGGGGAGGGGGAAGG - Intronic
995494327 5:112725456-112725478 CAAAAGGAGAAGGAGGGGCCGGG + Intronic
995759748 5:115550864-115550886 AAAAGTCAGCAGGAGGGGGGTGG + Intergenic
996393630 5:122990048-122990070 GAAAGTTAGGAGGAGGGGCTTGG - Intronic
996544101 5:124659452-124659474 CAAAGGAAGGAGGAGCAGGCAGG + Intronic
996843722 5:127876728-127876750 CAAATGGAGGAGGAGGAAGCAGG + Intergenic
997872412 5:137517151-137517173 CAAATTCAGGAGGAGGGGCAGGG + Intronic
997893643 5:137696664-137696686 CACAGTGAGTCAGAGGGGGCTGG + Intronic
998143529 5:139712626-139712648 AGATGTGAGGAGGAGGGGGCAGG + Intergenic
998170578 5:139870056-139870078 CACAGGGAGGAGGAGGGTGCAGG + Intronic
998376251 5:141692753-141692775 GACACCGAGGAGGAGGGGGCAGG - Intergenic
998571035 5:143258232-143258254 AAAAGAGAGGGGGAGGGGGAGGG - Intergenic
999141395 5:149364838-149364860 AAAGGTGATGGGGAGGGGGCTGG - Intronic
999873527 5:155776655-155776677 CATAGTGAAGCTGAGGGGGCTGG - Intergenic
1000199917 5:158997994-158998016 CAGAATGAGGAGGAGGTAGCAGG - Intronic
1000932707 5:167271194-167271216 CATGGTGAGGAGGAGTGGGGAGG + Intergenic
1001557555 5:172646935-172646957 GAAAGTCTGGAGGCGGGGGCCGG + Intronic
1001565150 5:172695291-172695313 CATTGTCAGGAGGAGGGGGAGGG + Intergenic
1002467212 5:179413612-179413634 CAGAGTGAGGATGTGGGGACAGG - Intergenic
1002904895 6:1440314-1440336 GAAAGTTTGGAGGAGGGGACTGG + Intergenic
1002924052 6:1594710-1594732 CCAAGGGAGGAGGGAGGGGCAGG + Intergenic
1003113878 6:3270503-3270525 CAGCCTGAGGAGGAGGAGGCCGG - Exonic
1003381021 6:5624824-5624846 CAAAATGAGGGGGCGGGGGCGGG - Intronic
1004314636 6:14575190-14575212 CAAAGTGAGGATGATAGGGAGGG - Intergenic
1004902543 6:20207405-20207427 CAAATTCAGCAGGACGGGGCAGG + Intronic
1005039641 6:21589190-21589212 ACAAGTGAGCAGGAGGCGGCGGG + Intergenic
1005048520 6:21664450-21664472 CAAAGTGAGGCCGAGAGCGCAGG - Intergenic
1005223927 6:23620001-23620023 GAGAGAGAGGGGGAGGGGGCGGG + Intergenic
1005413249 6:25573141-25573163 CAAGGGGAGGAGGATGGGGAGGG + Intronic
1005545940 6:26871522-26871544 CAAGGTGAGGTGGAGGAAGCAGG + Intergenic
1006307826 6:33235261-33235283 CTGAGTGAGGTGGAGGGGTCTGG + Intergenic
1006360294 6:33583797-33583819 ACATGTGAGGAGGAGGGGGCCGG + Intergenic
1006400268 6:33813508-33813530 CAATGGGAGGAAGAGGAGGCTGG - Intergenic
1006440442 6:34050465-34050487 GAAAGAGAGGAGGAGGAGCCAGG - Intronic
1006574131 6:35031530-35031552 CAAAATGGGGAGGAGGAGGAAGG - Intronic
1006650193 6:35545043-35545065 CAAGAGGAGGAGGAGGGGACAGG + Intergenic
1006749126 6:36365603-36365625 AAAACTGAGGATGAGGGGGCTGG + Intronic
1007171316 6:39865411-39865433 CCTTGTGAGGATGAGGGGGCAGG + Intronic
1007220351 6:40274110-40274132 GAAAATGAGGAAGAGAGGGCTGG + Intergenic
1007382930 6:41502416-41502438 CAGAGTGAACAGGAGCGGGCAGG + Intergenic
1007511861 6:42380185-42380207 AACAGTGAGGAGGAGGGGACAGG + Intronic
1008261210 6:49368408-49368430 CAAAATGTGGAGGGTGGGGCCGG + Intergenic
1008462398 6:51790708-51790730 AAAAGTGAGGAGGAAAGGGAGGG - Intronic
1008592614 6:53009284-53009306 GAAAGAGAGGAGGATAGGGCTGG + Intronic
1009016653 6:57912307-57912329 CAAGGTGAGGTGGAGGAAGCAGG + Intergenic
1009647939 6:66432218-66432240 GAAAGTGAGGAGCAAGGGGAGGG - Intergenic
1010085533 6:71913488-71913510 CAAAGAGATGGGGCGGGGGCAGG - Intronic
1010198082 6:73259685-73259707 AAAAGTGTGGAGAAGGGGCCAGG - Intronic
1010726875 6:79345093-79345115 TAAAGTTAGGAATAGGGGGCAGG + Intergenic
1010752497 6:79631241-79631263 GAGAGGGAGGAGGAGGGAGCCGG - Intergenic
1011749905 6:90444725-90444747 AACACTGAAGAGGAGGGGGCGGG + Intergenic
1013033908 6:106361549-106361571 CGAAGGGAGGAGGAAGTGGCAGG + Intergenic
1013272337 6:108556849-108556871 CACAGTGAGGAATGGGGGGCAGG - Intergenic
1013328760 6:109075938-109075960 CAAAGGGAGGAGCAGGGTCCAGG - Intronic
1013675877 6:112462059-112462081 AAAAGTGGGGGGGAGGGGACGGG - Intergenic
1013836796 6:114343157-114343179 GAAAGGGAGGAGGAGGAGGGTGG + Intergenic
1014303371 6:119711258-119711280 CAAGCTGAGGAGGAGGGGTTTGG - Intergenic
1014804868 6:125818095-125818117 GAAAGTAAGGAGGAGGAGGAAGG - Intronic
1015036420 6:128660763-128660785 AAAAGTGAGGAGGAGTGGGAAGG + Intergenic
1015228482 6:130886022-130886044 CAAAGTGAGTAGTAGGTGGCAGG + Intronic
1015471319 6:133609996-133610018 CAAAGTGGGGAGGGGGGAGGTGG - Intergenic
1016544256 6:145202732-145202754 CAAGGTGAGGAAGTGGGGTCTGG - Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017711515 6:157172988-157173010 CAGAGTGAGGAAGAGAGGGAAGG - Intronic
1017774553 6:157670646-157670668 CAAAGTGCGGGGGAGGGGAGGGG - Intronic
1018076101 6:160214997-160215019 CAAAGTGAGGAGGGCATGGCGGG - Intronic
1018298631 6:162376765-162376787 GAAAGGGAGGGGGAGGGGGAGGG + Intronic
1018560629 6:165098145-165098167 CTAAGGGAGGAGGGGAGGGCCGG - Intergenic
1018998789 6:168729863-168729885 CAGAGTCAGGAAGAAGGGGCTGG - Intergenic
1019137342 6:169918545-169918567 CAAAGTGAGGAGGTCAGGGCTGG + Intergenic
1019158240 6:170052874-170052896 CAGAGGGAGGGGGAGGGGGAGGG - Intergenic
1019219499 6:170463005-170463027 GGAAGTGATGGGGAGGGGGCTGG + Intergenic
1019283448 7:211687-211709 CTAAGCGGGGAGGTGGGGGCCGG + Intronic
1019404546 7:876834-876856 CAATGGGAGGCGGCGGGGGCGGG - Intronic
1019423360 7:962129-962151 CACTGTGGGGAGGAGGGGTCAGG - Intronic
1019453508 7:1112385-1112407 CAGAGTGAGCAGGTGGAGGCCGG - Intronic
1019562828 7:1666631-1666653 CAGAAAGAGGGGGAGGGGGCTGG + Intergenic
1019697327 7:2452763-2452785 CAAAGGGACGAGGAGGGGAGGGG - Intergenic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1019884209 7:3889933-3889955 AAAAGTGAGGAGGAGGAGCGGGG - Intronic
1020080244 7:5282859-5282881 AAGAGGGAGGAGGAGGGGGGAGG + Intronic
1020595138 7:10197572-10197594 GAAAGGGTGGAGGAGGGGGAGGG - Intergenic
1021280237 7:18708135-18708157 AAGAGTGTAGAGGAGGGGGCAGG + Intronic
1021483349 7:21142693-21142715 CACAGTGAGGAGTAGGGGAGGGG + Intergenic
1021510609 7:21428365-21428387 TAAGGGGAGGAGGAGAGGGCGGG + Intronic
1021647706 7:22802545-22802567 CAGGGGGAGGAGAAGGGGGCTGG - Intergenic
1021682814 7:23151914-23151936 GAAAGTGAGGGGGAAGAGGCAGG - Intronic
1021744585 7:23725954-23725976 CAAAGGGAGGAAGAGGTGCCAGG + Intronic
1021768129 7:23969749-23969771 CAACGTGAGGAAGCAGGGGCTGG - Intergenic
1021790134 7:24196345-24196367 CAAAGAGAGGGGGAGAGGTCAGG - Intergenic
1021960526 7:25868297-25868319 CAAACTGAGGAGGAGGAAGTGGG - Intergenic
1022545146 7:31180328-31180350 AAAGGTAAGGTGGAGGGGGCAGG - Intergenic
1022834079 7:34097178-34097200 CAAAAAGAGGAGCAGGAGGCTGG + Intronic
1023055590 7:36287391-36287413 CTAAGTGAGGAGTAGGCGGTGGG + Intronic
1023558141 7:41444815-41444837 CAAAATGAGGAGAAGGTGCCAGG - Intergenic
1023792389 7:43763208-43763230 CAGAGCTGGGAGGAGGGGGCTGG + Intronic
1023850209 7:44146133-44146155 CAAGGGGAGGAGGCGGGGTCCGG - Intronic
1024178368 7:46863433-46863455 CCATGTGAGAAAGAGGGGGCGGG - Intergenic
1024532861 7:50407526-50407548 CAGAGTGAGGAGGTGGGGTTGGG + Intergenic
1025035066 7:55588805-55588827 CAGAGTCAGGAGAATGGGGCAGG - Intergenic
1025215388 7:57051679-57051701 GAAAGAGAGGAGGAGGTGCCAGG - Intergenic
1025297730 7:57789586-57789608 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1025307294 7:57873035-57873057 AAAAAGGAGGAGGAGGGGGAGGG + Intergenic
1026800648 7:73397867-73397889 AAGAGTGAGGAGGAGGCGGGGGG + Intergenic
1026865988 7:73824380-73824402 TGAAGTGAGGAGGCGGGAGCCGG + Intronic
1026885812 7:73943812-73943834 AATAGAGAGGAGGAGGTGGCAGG + Intergenic
1026939755 7:74280683-74280705 GAGAGAGAGGAGGAGGAGGCTGG - Intergenic
1027172032 7:75879257-75879279 CAAGGTGAGCAGGGGCGGGCCGG + Exonic
1027816571 7:82980185-82980207 AAAAGTGAGGATGTGGGGCCTGG + Intronic
1028493316 7:91438270-91438292 CAAAGTGAGAAGAGGGGGCCTGG + Intergenic
1028985488 7:97005716-97005738 CAAAGGGAGGAGGAAGGAGGAGG - Exonic
1029198838 7:98825445-98825467 GAGAGTGAGGAGGAGGTGCCAGG - Intergenic
1029420237 7:100468244-100468266 CAGAGTGGAGGGGAGGGGGCCGG + Intronic
1030713552 7:112782918-112782940 CAATGGGAGGAGGAAGAGGCTGG - Intronic
1030876014 7:114814364-114814386 CCAAGTGAGGAGTTAGGGGCTGG - Intergenic
1031018177 7:116597931-116597953 GAAAGAGAGGAGCAGTGGGCTGG - Intergenic
1031991849 7:128203550-128203572 GAAAGGGAGGAGGAGGGGCAAGG - Intergenic
1032090492 7:128909297-128909319 CAGAGAGAGGAGGAGGGAGAGGG + Intronic
1032151614 7:129434371-129434393 CCAATAGAGGTGGAGGGGGCGGG + Intronic
1032441636 7:131946640-131946662 GAAACGGAGGAGGAGGAGGCAGG + Intergenic
1033332687 7:140429320-140429342 CTAAGAGTGGAGCAGGGGGCTGG - Intergenic
1033577636 7:142701484-142701506 CAAAGGCAGAAGGAGGGGGTGGG + Intergenic
1034356467 7:150454147-150454169 CAATGTGAGGGGAAGGGGGTGGG + Intronic
1034380460 7:150687875-150687897 GAGAGTGAGGAGGAGGGAGTGGG - Intronic
1034438681 7:151075874-151075896 TACAGAGAGGAGGTGGGGGCTGG - Intronic
1035123129 7:156585541-156585563 CAAAGGGAGCCAGAGGGGGCTGG - Intergenic
1035161138 7:156950509-156950531 GAAAGTGAGGAGGAGGAGGAGGG + Exonic
1035162513 7:156961374-156961396 CAGTCTGAAGAGGAGGGGGCTGG + Intronic
1035198066 7:157239773-157239795 CAAAGTGAGGGTGTGGGGTCTGG + Intronic
1035265294 7:157686761-157686783 AGAAGTGAGGAGGAGGAGGAGGG + Intronic
1035291307 7:157840953-157840975 TTGAGAGAGGAGGAGGGGGCAGG - Intronic
1035821986 8:2603038-2603060 CCAAGTTAGGAGGTGGGGCCTGG - Intergenic
1036180365 8:6579293-6579315 CAAATGGAGGAGAAGGGGACCGG - Intronic
1036283932 8:7426804-7426826 CAAAGAGAGGAGAAAAGGGCTGG - Intergenic
1036337543 8:7884726-7884748 CAAAGAGAGGAGAAAAGGGCTGG + Intergenic
1036557852 8:9875794-9875816 CAAAATGAGGAAGAGGTGGCTGG + Intergenic
1037147638 8:15592529-15592551 GAGAGTTAGGAGGAGGTGGCAGG - Intronic
1037497048 8:19450217-19450239 AAGAGGGAGGGGGAGGGGGCAGG + Intronic
1037893638 8:22637320-22637342 CAGAGTGCAGAGGAGAGGGCGGG + Intronic
1037906923 8:22721002-22721024 CAAAGGTAGGAGGAGTGGGGTGG + Intronic
1039434020 8:37547297-37547319 CAAGCCAAGGAGGAGGGGGCTGG - Intergenic
1039664951 8:39515810-39515832 CAATGTGAGGAGGAGAGTGCAGG - Intergenic
1042056840 8:64772928-64772950 CAAAGTGAGAAGGAGGAGATGGG - Intronic
1042154054 8:65822204-65822226 CAAGGTCAGAATGAGGGGGCAGG - Intronic
1042380278 8:68105254-68105276 CTAAGAGAGGAGGAGGCAGCAGG - Intronic
1042865886 8:73356600-73356622 TGGAGGGAGGAGGAGGGGGCTGG - Intergenic
1042926989 8:73976516-73976538 CCAAGTGAGGCGGGGAGGGCGGG + Intronic
1043455577 8:80408864-80408886 AAAAGCGAGGAGGAGGAGGCAGG - Intergenic
1043920704 8:85980246-85980268 GAGAGAGAGGAGGAGGGGCCAGG - Intergenic
1044064485 8:87682733-87682755 GAAAGTGAGGAGAAGGGGTCTGG + Intergenic
1045089625 8:98728067-98728089 CTAGGAGAGGAGGAGGGGGCAGG - Intronic
1046937239 8:119896307-119896329 CAAGGTGAGCAGGTGGGAGCTGG + Intronic
1047167917 8:122461311-122461333 CTGAGTAAGAAGGAGGGGGCTGG + Intergenic
1047446863 8:124927617-124927639 CAAAGGAAGGAGGAGGAAGCCGG + Intergenic
1048236074 8:132692065-132692087 AAAAGAGAGTAGTAGGGGGCTGG + Intronic
1048293435 8:133197559-133197581 CATAGAGAGGAGGAGGAGGAGGG - Intronic
1048395610 8:134011303-134011325 CACAGTCAGGTGCAGGGGGCGGG + Intergenic
1048407484 8:134138168-134138190 CAAAGTGAGGAGGAGAGACAGGG - Intergenic
1048978477 8:139689402-139689424 CATGGTGAGGAGTAGGTGGCAGG + Intronic
1048980097 8:139698622-139698644 TTGAGTGAGGAGGAGGGAGCTGG - Intronic
1049650856 8:143768580-143768602 CAATGGGTGTAGGAGGGGGCAGG - Intergenic
1050191107 9:3027391-3027413 CAAAGTGAAGAGGAGGAGGCTGG + Intergenic
1052330252 9:27260316-27260338 GAAAGGGTGGAAGAGGGGGCAGG + Intergenic
1052370983 9:27664215-27664237 AGAATTGAGGAGGAGGGGGATGG - Intergenic
1052531191 9:29686312-29686334 GAGAGGGAGGAGGAGGGGGAGGG + Intergenic
1052996183 9:34552640-34552662 CAAAGCCAGGAGGTAGGGGCGGG + Intronic
1053151266 9:35744722-35744744 CAATGTGAGTGGAAGGGGGCAGG + Intronic
1053454960 9:38226893-38226915 CAGAGTAAGGGGGCGGGGGCTGG + Intergenic
1053795877 9:41726445-41726467 CAAATTATGGAGGAGGGGGCAGG - Intergenic
1054149302 9:61588428-61588450 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1054184284 9:61938516-61938538 CAAATTATGGAGGAGGGGGCAGG - Intergenic
1054469064 9:65519539-65519561 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1054654222 9:67649979-67650001 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1055212743 9:73817034-73817056 GAAAGTGGAGAGGAGGGGGAAGG + Intergenic
1055580732 9:77703834-77703856 CAAAGTGAGGGAGAGGGAGAGGG + Intergenic
1055954780 9:81763455-81763477 AAAGGTGGGGAAGAGGGGGCAGG + Intergenic
1056002020 9:82227658-82227680 CCAAGTGAGGAGGAATGGACAGG + Intergenic
1056659605 9:88534634-88534656 CGCAGTGAGGGGGAGGGCGCGGG + Intergenic
1056796130 9:89660034-89660056 TGAAGTGAGGTGCAGGGGGCAGG + Intergenic
1057280975 9:93711279-93711301 CCAAGTGCGGAGGAGGGAGGAGG + Intergenic
1057339681 9:94188819-94188841 CAAGGTGTGGTGGATGGGGCAGG - Intergenic
1057344059 9:94231996-94232018 CAAAGTGAGGTGGGGGGTGGGGG + Intergenic
1057703885 9:97384415-97384437 CAAAGTGGGCAGGAGTGGGGGGG - Intergenic
1057713454 9:97468219-97468241 CGTAGAGAGGAGGAGGGGCCTGG + Intronic
1057966842 9:99512540-99512562 GAAAGTGAGGTTGAGGGGTCAGG - Intergenic
1058151493 9:101468444-101468466 CAATGGGAGTAGGAAGGGGCTGG - Intergenic
1058457206 9:105148668-105148690 GAAAGAAAGGAGGAGGAGGCAGG + Intergenic
1059165567 9:112073509-112073531 CAGAGAGAGGAGGATGGGGGTGG - Intronic
1059220693 9:112615123-112615145 AAAAATGAAGAGGAGGAGGCCGG + Intronic
1059357155 9:113708824-113708846 GAAACTGAGGAAGAGGGGCCAGG - Intergenic
1059433644 9:114264224-114264246 AAGTGGGAGGAGGAGGGGGCCGG + Intronic
1059847966 9:118302661-118302683 CAAAGTGAGGAAGGAGGGCCTGG + Intergenic
1059909442 9:119026178-119026200 TAAAGTGAAGAGGTGGAGGCTGG - Intergenic
1060776272 9:126376997-126377019 GCAAGTGTGGGGGAGGGGGCGGG - Intronic
1060813277 9:126622086-126622108 CAAAGGGAGGATGAGGGGCTGGG + Intronic
1061151132 9:128828981-128829003 CAAAGTGGGGAGGCAGGGGCCGG - Intronic
1061369140 9:130188004-130188026 CAAAGTGGGGAGATGGGGGGTGG + Intronic
1061481111 9:130898138-130898160 CAAAGTGAGGAGGCTGGAACTGG + Intergenic
1061619663 9:131803647-131803669 CAGAGGTAGGAGGAGGGAGCAGG + Intergenic
1061788362 9:133044564-133044586 CAAAGAGAGGAGGGCAGGGCAGG - Intronic
1061912205 9:133731247-133731269 CTAAGGCAGGAGGAGTGGGCTGG + Intronic
1062051075 9:134447420-134447442 CAGAGGGAGGAGGATGCGGCTGG + Intergenic
1062152708 9:135030164-135030186 CCACATCAGGAGGAGGGGGCAGG - Intergenic
1062281729 9:135754912-135754934 CCAAGAGAGGAGGATGGAGCAGG - Intronic
1062358930 9:136178344-136178366 TAGAGTGAGGAGCCGGGGGCGGG - Intergenic
1062607144 9:137353430-137353452 CATAATGAGGAGGAGGGGAAGGG - Intronic
1062618372 9:137408102-137408124 GAACGTGAGGAGGAGGGGCTGGG - Intronic
1062708729 9:137960190-137960212 CTGAGTGAGGGGGAGGGGGAGGG + Intronic
1062711222 9:137976150-137976172 GACAGTGAGGAGCAGGGGGCTGG + Intronic
1062733574 9:138122130-138122152 AAAAGAGGGGAGGAGGGGGAGGG - Exonic
1185505483 X:630176-630198 GAAAGTGAGAAGAAGGGGCCGGG - Intronic
1186410669 X:9342460-9342482 AAAACGGAGGAGGAGGGGGGAGG - Intergenic
1186576190 X:10768652-10768674 AAAAGTGAGGAGGAGAGTGAGGG - Intronic
1187160589 X:16761559-16761581 CAAGGTGAGGAGGCTGAGGCAGG + Exonic
1187447679 X:19373164-19373186 GGAAGGGAGGAGGAGGGGCCAGG + Intronic
1187533756 X:20118691-20118713 GAAAGTGAGCAGGTGGGGGCTGG + Intergenic
1187983991 X:24790560-24790582 CTAAGTCAGCAGGAGGGAGCAGG - Intronic
1188404286 X:29787243-29787265 GAAATGGAGGATGAGGGGGCTGG + Intronic
1189332910 X:40154057-40154079 CAAAGGGAGGCGGCGGGGGAGGG + Intronic
1189630027 X:42943003-42943025 CAAAGAGAGGTGGTGGGGGTAGG + Intergenic
1190274171 X:48889864-48889886 AAAAGTGAGAAGGAGGGGCCAGG - Intergenic
1190629300 X:52369221-52369243 GAATGTGAGGAGGAGTGAGCGGG + Intronic
1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG + Intergenic
1190755962 X:53402446-53402468 CAACGTGAGGTGGAGGGAGGCGG - Intronic
1190761184 X:53439518-53439540 AAAAGTGAGGAGGTGGGGGCCGG - Intergenic
1191171469 X:57451818-57451840 CAAAGAAAGCAGGATGGGGCAGG - Intronic
1192216467 X:69162844-69162866 GATAGTGAGGAGGAGGGGGCTGG - Exonic
1192260630 X:69504331-69504353 CACGGAGAGGAGGAGGGAGCGGG - Intergenic
1192264661 X:69530229-69530251 AAAAGGGAGGAAGTGGGGGCTGG + Exonic
1192533642 X:71910791-71910813 AAAAGAGAGGAGGAGGAGGGGGG + Intergenic
1192629952 X:72769617-72769639 CACAATGAGGAGGATGGGGAAGG - Intergenic
1192651758 X:72951187-72951209 CACAATGAGGAGGATGGGGAAGG + Intergenic
1193131865 X:77928897-77928919 CAAAATGATGACTAGGGGGCAGG - Intronic
1195104849 X:101593848-101593870 CACAGTGAGGAGGAAGGGATTGG + Intergenic
1195748246 X:108139440-108139462 TAAAGAGAGGAAGAAGGGGCTGG - Intronic
1196237581 X:113300064-113300086 CAGAGAGAGGAGGAGGGGAAGGG - Intergenic
1196976280 X:121161357-121161379 CAAAGGGAGAATGAGGGGGAAGG - Intergenic
1198532986 X:137563614-137563636 AGAAGTGGGGAGGTGGGGGCCGG - Intergenic
1199800746 X:151248371-151248393 CAGAGGGAGGGGGAGGGGGAGGG + Intergenic
1200108869 X:153728921-153728943 CCGAGCCAGGAGGAGGGGGCTGG + Intronic
1200256597 X:154585852-154585874 TCGAGTGATGAGGAGGGGGCCGG + Intronic
1200261172 X:154618551-154618573 TCGAGTGATGAGGAGGGGGCCGG - Intronic
1201195075 Y:11485302-11485324 AAAAAGGAGGAGGAGGGGGAGGG + Intergenic