ID: 986430945

View in Genome Browser
Species Human (GRCh38)
Location 5:7680345-7680367
Sequence CAAAATGCTGATAGCGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 165}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986430938_986430945 4 Left 986430938 5:7680318-7680340 CCCCCCACAGCAAAGAGCCATGT 0: 1
1: 0
2: 2
3: 18
4: 200
Right 986430945 5:7680345-7680367 CAAAATGCTGATAGCGCTGAGGG 0: 1
1: 0
2: 0
3: 18
4: 165
986430939_986430945 3 Left 986430939 5:7680319-7680341 CCCCCACAGCAAAGAGCCATGTC 0: 1
1: 0
2: 1
3: 10
4: 176
Right 986430945 5:7680345-7680367 CAAAATGCTGATAGCGCTGAGGG 0: 1
1: 0
2: 0
3: 18
4: 165
986430940_986430945 2 Left 986430940 5:7680320-7680342 CCCCACAGCAAAGAGCCATGTCG 0: 1
1: 0
2: 0
3: 11
4: 98
Right 986430945 5:7680345-7680367 CAAAATGCTGATAGCGCTGAGGG 0: 1
1: 0
2: 0
3: 18
4: 165
986430941_986430945 1 Left 986430941 5:7680321-7680343 CCCACAGCAAAGAGCCATGTCGC 0: 1
1: 0
2: 1
3: 10
4: 90
Right 986430945 5:7680345-7680367 CAAAATGCTGATAGCGCTGAGGG 0: 1
1: 0
2: 0
3: 18
4: 165
986430937_986430945 23 Left 986430937 5:7680299-7680321 CCTGCAGTTTGCACGTCAGCCCC 0: 1
1: 0
2: 1
3: 8
4: 111
Right 986430945 5:7680345-7680367 CAAAATGCTGATAGCGCTGAGGG 0: 1
1: 0
2: 0
3: 18
4: 165
986430942_986430945 0 Left 986430942 5:7680322-7680344 CCACAGCAAAGAGCCATGTCGCT 0: 1
1: 0
2: 0
3: 12
4: 87
Right 986430945 5:7680345-7680367 CAAAATGCTGATAGCGCTGAGGG 0: 1
1: 0
2: 0
3: 18
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986430945 Original CRISPR CAAAATGCTGATAGCGCTGA GGG Intronic
907198036 1:52703205-52703227 CAAAATGCTGAGAGTCCCGAGGG - Intergenic
907784754 1:57600552-57600574 CAAAATGCTTAGAGCCCTGGGGG + Intronic
907946050 1:59137609-59137631 CAAAGTGCTTATAGGGCTGCAGG - Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909236019 1:73153345-73153367 GAAAATGCTGATAGTGATAATGG - Intergenic
915856664 1:159396092-159396114 CAAAATGTTGGTAGCCTTGAAGG + Intergenic
917124673 1:171676518-171676540 CAAAATGTTAAGAGTGCTGAGGG - Intergenic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
1064760281 10:18611871-18611893 CTAAATGCTGTTAGAACTGAGGG - Intronic
1071007580 10:80900567-80900589 CAAAATGCCAATAGTGCTGAGGG + Intergenic
1072185944 10:93039156-93039178 CAAAAGGCTGATATTGCTGAAGG + Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073152200 10:101319735-101319757 CAAAATGCTGATAAGCCTGTGGG + Intergenic
1077876163 11:6308569-6308591 CAAAATGTTAATAGTGATGAGGG - Intergenic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1080857733 11:36126605-36126627 AACAAGGCTGATAGCCCTGATGG - Intronic
1080889247 11:36394972-36394994 TATAATGCTTATAGCTCTGAAGG - Intronic
1081122757 11:39286521-39286543 CAAAATACTGATAGCGATATGGG - Intergenic
1083312617 11:61792540-61792562 CAAAATGGTGAGAGCGTTGAGGG - Exonic
1085307452 11:75496071-75496093 CAAGATGCTGTTGGAGCTGAAGG - Intronic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1092486003 12:8902533-8902555 CAAAATGCTGATAGCGATATAGG - Intergenic
1094540834 12:31362234-31362256 AAAACTGCTGAGAGTGCTGACGG + Intergenic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1105766382 13:23564063-23564085 CAAAATGCTGACAAGGCTGCAGG + Intergenic
1105982087 13:25527781-25527803 CAAAATGCTGACTGTGCTTAAGG - Intronic
1111580551 13:90217454-90217476 GAAAATGATGATAGGGATGACGG + Intergenic
1112396665 13:99039813-99039835 AAAATTTCTGATAGCACTGAGGG + Intronic
1112987239 13:105466285-105466307 CAAAATGCTGGAAAAGCTGATGG + Exonic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114882851 14:26808112-26808134 CAAAATACTAATAGCTCAGATGG + Intergenic
1115024653 14:28729094-28729116 CAATAAGCTGATAGACCTGAAGG + Intergenic
1116147848 14:41098975-41098997 CAAAATGCTGATAGCAATATGGG + Intergenic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1117402225 14:55368831-55368853 CAAAATGCTCATAGTGTGGATGG + Exonic
1117456095 14:55898350-55898372 CAAAATCCAGACAGGGCTGAGGG - Intergenic
1117462258 14:55956902-55956924 CAAAATGTTTATAAAGCTGATGG - Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1121033689 14:90681615-90681637 TACAATGCTGATACCGCTGGAGG + Intronic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1124045307 15:26144013-26144035 AATAATGCTGAAAGGGCTGAAGG + Intergenic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1127643800 15:60940094-60940116 AAAAATGCTGATAGGGTTGGAGG - Intronic
1131320034 15:91379610-91379632 AAGAATGCTGATAGCGGGGAAGG - Intergenic
1139041240 16:63001518-63001540 CAAAATGCTGATAGTAATGTGGG + Intergenic
1140924082 16:79566321-79566343 CAAAAGGCTGTAAGAGCTGAGGG + Intergenic
1141894031 16:86947117-86947139 CAACATGCTGATGCTGCTGACGG + Intergenic
1203141445 16_KI270728v1_random:1769858-1769880 CAAAGTGCTGAAAGTACTGAAGG - Intergenic
1142955481 17:3518629-3518651 CAACATGCTCATTGCTCTGATGG - Exonic
1143744721 17:8983730-8983752 GAAAATGCTGATTGGGGTGATGG + Intergenic
1146259796 17:31413801-31413823 AAAACTGCTGATAGCACTGTAGG - Intronic
1146408864 17:32564827-32564849 CAAAATGCAGACAGGCCTGATGG - Intronic
1147533803 17:41304519-41304541 GAAAATACTGAAAACGCTGAAGG + Intergenic
1150277641 17:63910155-63910177 CCAAATGCTGATGGGGGTGAGGG - Exonic
1155589911 18:27415177-27415199 AAAAATGCAGTTAGCACTGATGG + Intergenic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1157296283 18:46447617-46447639 GGTAATGCTGATAGTGCTGAGGG - Exonic
1158754219 18:60302709-60302731 TATAATGCTGATAGTGTTGATGG + Intergenic
1159049948 18:63411494-63411516 CAGCATGCTGATAGAGCTGAAGG + Exonic
1161605916 19:5214883-5214905 CCAAATGGTGATGGCGCTGAGGG - Intronic
1164890698 19:31820832-31820854 CAAAATCCTGAAAGCTCAGAAGG + Intergenic
1166017420 19:39993266-39993288 TAAAATGCTGATAGTGATAACGG + Intronic
925753164 2:7108249-7108271 CAAAAGGCTGATATCCCAGAAGG - Intergenic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
934912305 2:98270497-98270519 CAAAGTCCTGATAGAGCAGAGGG + Intronic
935174712 2:100639892-100639914 CAATATCGTGATAGCCCTGATGG + Intergenic
935902775 2:107810314-107810336 CAAGTTGCGGATAGCTCTGAAGG - Intergenic
936761345 2:115787919-115787941 CAAAATGCTGCAAATGCTGACGG + Intronic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
941232044 2:162922529-162922551 CAAAATCATGATAGAGATGATGG + Intergenic
941650911 2:168091755-168091777 CAAAATGTTGATAATGTTGAAGG - Intronic
942382109 2:175402696-175402718 CAAATTGCTGAAATTGCTGACGG + Intergenic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
946629993 2:221656658-221656680 CAAAATATCAATAGCGCTGAGGG + Intergenic
947269326 2:228316391-228316413 CAAAATACTTATAACGCTTAAGG - Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
1173323519 20:42010746-42010768 CAAAATGCTGACAGTGATAATGG - Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1178143882 21:29716492-29716514 CAAAATGCTGATAGTAATGTGGG + Intronic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
954212808 3:49107867-49107889 CAAAAAGCTGATAGCACTGGGGG + Intergenic
956287958 3:67630434-67630456 CTAAATGCTTATAGCGTTAATGG - Intronic
956968816 3:74496711-74496733 GTAACTGCTGATAGTGCTGAAGG - Intronic
956987560 3:74719848-74719870 CAAAAAACTGATAGAACTGAAGG - Intergenic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
961428845 3:126865600-126865622 CAAAATGGTGGTAGCAGTGAAGG - Intronic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963433805 3:145242550-145242572 CAACATGCTGATAGTGATAAGGG - Intergenic
964225167 3:154389945-154389967 CAAAACTCTGATTGTGCTGAGGG + Intronic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
965326460 3:167310228-167310250 CAAAATGCTTATAGTGATAATGG - Intronic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
969545164 4:7821333-7821355 CAAAATGCTGACAGTAATGACGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
971972478 4:33637752-33637774 CAAAATGCTGATAGAGAATAAGG - Intergenic
973056813 4:45669989-45670011 CAAATTGCTCATATCGTTGAAGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
973978823 4:56289177-56289199 CTAAAAGTTGATAGTGCTGATGG + Intronic
976231484 4:82848009-82848031 CAAATTGCTGATAGGATTGATGG - Intronic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
979060987 4:116059935-116059957 CAAAGTGCTGATAGTGATGTGGG - Intergenic
979125708 4:116969397-116969419 CAAAATGCTAATAGTGCTATTGG - Intergenic
980824207 4:138053772-138053794 CAGAATGCTGATTGCGCAGCAGG + Intergenic
981016236 4:139977331-139977353 TAAAATGCTGATAGTGCCGAGGG + Intronic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
982651529 4:158093448-158093470 CAAAATACGGATAACCCTGAAGG + Intergenic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
985414397 4:189721651-189721673 CAAACTGCCCATAGTGCTGAGGG + Intergenic
986430945 5:7680345-7680367 CAAAATGCTGATAGCGCTGAGGG + Intronic
987533209 5:19148797-19148819 CAAAATGCTGATAGTGACGAGGG - Intergenic
987955193 5:24729719-24729741 CAAAAACCTGATAGCGGTGGAGG - Intergenic
988076760 5:26363821-26363843 CAATATGCTGATAGTGATAAGGG + Intergenic
988699567 5:33660080-33660102 CCAAATGTTAATAGTGCTGAGGG + Intronic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
992656205 5:78912314-78912336 CAATATGTTGATATCGTTGATGG - Intronic
992710863 5:79454668-79454690 CAAAGTGCAAATAGCGCTTAGGG + Intronic
993139472 5:84012420-84012442 CTGAATGATGATAGCCCTGAAGG - Intronic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
995211964 5:109550959-109550981 CAAAATGCTGATAGCCATATGGG + Intergenic
996268452 5:121572736-121572758 CAAAATGTTGATAGCCCTCTGGG - Intergenic
997184130 5:131864833-131864855 CAAAGTGTTGATATCCCTGAAGG - Intronic
997637157 5:135420720-135420742 CAAAATTCTGAAAGTGCTCAAGG - Intergenic
999747583 5:154604113-154604135 CTAAATGCTGCTGGGGCTGATGG + Intergenic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1004324043 6:14657468-14657490 CACAATGCTGATAGGGCTATTGG - Intergenic
1006344060 6:33465786-33465808 CAAAATGCTGATAGCAATATGGG + Intergenic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1012015689 6:93847182-93847204 CAAAATGCTGATAGAAATTAAGG + Intergenic
1013254970 6:108375760-108375782 AAAAAGGCTGATATCCCTGATGG - Intronic
1013332418 6:109117903-109117925 CCAAATGCTGAAAGTGCTGAGGG - Intronic
1017502614 6:155039440-155039462 CAAAATGCTGATGGCCATGGTGG + Intronic
1018840966 6:167516444-167516466 CAAGATGCTGATGACGATGATGG - Intergenic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1028410380 7:90524213-90524235 TAGAATGATGATAGAGCTGAAGG - Intronic
1030700460 7:112632937-112632959 CAAAATGCAGAAGGCGCTGTGGG - Intergenic
1031261928 7:119532438-119532460 CAAAATTCTGATAGTGATGTGGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1036953744 8:13165537-13165559 CACAATGCTGTTAGTGCTGAAGG + Intronic
1038382510 8:27109825-27109847 TAAAATGCTGATGGGGATGAGGG - Intergenic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1039652306 8:39354791-39354813 CAAAATGCTGATGAGGCTGTGGG + Intergenic
1040547610 8:48411421-48411443 AAAAATGCTGAAAGAGCTAAAGG + Intergenic
1040710205 8:50178670-50178692 AAGAAGGCTGATAGAGCTGATGG - Intronic
1041472309 8:58224500-58224522 CATAATGCTGATTCAGCTGATGG - Intergenic
1043363911 8:79509490-79509512 CAAAATGCTGATGCAGCTGAAGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044262093 8:90137319-90137341 GAAAATGCTTATTGCTCTGAAGG - Intergenic
1045050589 8:98320677-98320699 CAAAATGCTGATAGCAATACGGG - Intergenic
1045120748 8:99031656-99031678 GAAAATGCTGATATTGATGACGG - Intronic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1049109363 8:140634146-140634168 CAAACTGCTGATGGCCCTCAGGG + Intronic
1050376007 9:4973836-4973858 CAAAATGTTGACAGCTATGAAGG + Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1052511011 9:29420641-29420663 CAAATTGCTGACAGAGATGAGGG - Intergenic
1059466935 9:114474879-114474901 CAACATGATGACAGTGCTGAAGG - Intronic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1185551746 X:987513-987535 CAAAGTGCTGAAAGTACTGAAGG + Intergenic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194955399 X:100173393-100173415 CTTAATACTGAGAGCGCTGATGG + Intergenic
1195342631 X:103919940-103919962 CAATGTGATGATAGTGCTGAGGG + Intronic
1196028954 X:111074781-111074803 CAAAATGCTGATGGAGATGTGGG + Intronic
1196677258 X:118432694-118432716 CAAAATGCTGAGAGAACAGATGG + Intronic
1199505407 X:148555593-148555615 AGAAATGCTGATATTGCTGAGGG - Intronic
1199785972 X:151105109-151105131 CAAAATGTCAATAGTGCTGAGGG + Intergenic
1199885766 X:152020592-152020614 CAAAATGATGGTAGAGCTTAAGG + Intergenic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic