ID: 986433941

View in Genome Browser
Species Human (GRCh38)
Location 5:7709521-7709543
Sequence GGCCCTTATGAACAACCATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 64}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986433938_986433941 21 Left 986433938 5:7709477-7709499 CCTTTCTGTAAGAAACAAACTTA 0: 1
1: 0
2: 2
3: 26
4: 384
Right 986433941 5:7709521-7709543 GGCCCTTATGAACAACCATCAGG 0: 1
1: 0
2: 0
3: 1
4: 64
986433940_986433941 -5 Left 986433940 5:7709503-7709525 CCTTCTTCTTCTCAGAGAGGCCC 0: 1
1: 0
2: 1
3: 28
4: 281
Right 986433941 5:7709521-7709543 GGCCCTTATGAACAACCATCAGG 0: 1
1: 0
2: 0
3: 1
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986433941 Original CRISPR GGCCCTTATGAACAACCATC AGG Intronic
900746592 1:4365177-4365199 GGTCCTTTTGAACAACTTTCTGG + Intergenic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
917750504 1:178049154-178049176 GGCCCTTAAAACCAACCACCAGG + Intergenic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
1072194111 10:93100753-93100775 GGCATTTATGAAAAACCTTCAGG - Intergenic
1075366982 10:121899892-121899914 GGTTCTTGTGAATAACCATCTGG + Exonic
1080192519 11:29569088-29569110 GGCAGTTATGATCAACCATATGG + Intergenic
1089849639 11:121485053-121485075 CGCCCTTAAGAACAAGCATGGGG - Intronic
1092106680 12:5926363-5926385 GGTCCTTACAAACATCCATCTGG + Intronic
1092125739 12:6073944-6073966 GGCCCTTACCAAGACCCATCGGG + Intronic
1096412626 12:51388225-51388247 GGCCTTTATCAACTAGCATCTGG + Intronic
1101116249 12:101534264-101534286 GGCCATTATGAAAAACAATGTGG + Intergenic
1104274501 12:127312785-127312807 GGGCCTTATGAACTACTTTCAGG - Intergenic
1114755501 14:25255021-25255043 GGACATGAAGAACAACCATCAGG - Intergenic
1119725832 14:76921315-76921337 GGGCCTTATTACCATCCATCTGG + Intergenic
1119785669 14:77311893-77311915 AGCCCTTAGGAACAATCCTCTGG + Intronic
1120361160 14:83504325-83504347 GGCCCTTTGGAACATCCATATGG + Intergenic
1120821426 14:88915133-88915155 GGCCCTTATGAACTATAATTAGG + Intergenic
1124874573 15:33579907-33579929 GGCCCTGATGAACACCCACTGGG - Intronic
1128067251 15:64773168-64773190 AGCCCCTAAGAGCAACCATCTGG - Intronic
1128852865 15:70978544-70978566 AGCTTTTATGAATAACCATCAGG + Intronic
1132457787 16:33658-33680 GGACCTTATGACCCACCATGTGG - Intergenic
1135760985 16:25137840-25137862 GACCCTTAAGAGCAAACATCAGG - Intronic
1137344242 16:47639777-47639799 GGCCATTATGTACAATCTTCAGG - Intronic
1159688582 18:71456791-71456813 GGCAATTATTAACAACCATCTGG + Intergenic
1164248746 19:23458383-23458405 GGCCCTTGTGGACAATAATCAGG - Intergenic
1164325590 19:24188545-24188567 GGCCCTTGTGAGCAACAACCAGG + Intergenic
1165767558 19:38360736-38360758 GTACCTTATGAACAACCAGAAGG + Exonic
926650749 2:15341629-15341651 GGGCCTTATGAAGAAACAGCGGG + Intronic
940474483 2:154144779-154144801 GGCAGTTGTGAATAACCATCAGG + Intronic
941742317 2:169047707-169047729 GGCCCTTGTTAACCACCGTCAGG - Intergenic
942902441 2:181137815-181137837 GGCATTTATAAACAAACATCTGG - Intergenic
1175240359 20:57543086-57543108 GGCCACTATGAACAAGCACCTGG + Intergenic
1182143877 22:27984853-27984875 GGCCCTTAAGAACATCAGTCGGG + Intronic
1182196120 22:28520250-28520272 GGACCTAATGAACTAACATCTGG + Intronic
953219977 3:40960768-40960790 TGCACTTTTGAACAACCATTGGG - Intergenic
954025864 3:47782334-47782356 GGCATTTGTGAACAGCCATCTGG + Intergenic
956655483 3:71546442-71546464 GGACCTTATGAAGAACCACATGG - Intronic
962578802 3:136778936-136778958 GGCCCTTATCAGTAAGCATCTGG + Intergenic
973019574 4:45185772-45185794 GGCCCTAATGATCTATCATCTGG + Intergenic
974485974 4:62506544-62506566 TGTCATGATGAACAACCATCTGG - Intergenic
978131513 4:105203736-105203758 GGCCGTTATTAACAACCTTGAGG + Intronic
978267018 4:106839158-106839180 AGCCCTTGAGAACAACCATGTGG - Intergenic
979808501 4:125005209-125005231 GGCCTTTGAAAACAACCATCAGG - Intergenic
979872465 4:125841161-125841183 GGGCCTTATGAACCACTTTCAGG + Intergenic
982059874 4:151594163-151594185 GTCCCTGATGAACATCGATCTGG - Intronic
984612199 4:181854024-181854046 AGCCCTTATTAAGAACCAACTGG - Intergenic
985290630 4:188383197-188383219 GGCCATTATGAAAAACCGTATGG - Intergenic
986433941 5:7709521-7709543 GGCCCTTATGAACAACCATCAGG + Intronic
993239484 5:85362610-85362632 AGCCATTATGAATAACAATCTGG - Intergenic
994438474 5:99769334-99769356 GTCCCTTCTGAACAACCTCCTGG - Intergenic
999659632 5:153846899-153846921 AGCCATTATGGACAACCATATGG - Intergenic
1006134334 6:31886822-31886844 GGCCGTGGTGAACAACCACCTGG - Exonic
1016806105 6:148213645-148213667 TGCTCTTATAAACAACCAACTGG + Intergenic
1022792960 7:33706953-33706975 AGCCCGTATGAATATCCATCAGG - Intergenic
1028009680 7:85625592-85625614 GGCTATTATGAACAACTATAGGG - Intergenic
1029042361 7:97590250-97590272 GGCCCCTGTGAGCAACTATCTGG - Intergenic
1042228713 8:66536002-66536024 GGCCCTTATGAAGAAGCCACAGG + Intergenic
1044788994 8:95826558-95826580 GGCCATTATGAAAAACATTCTGG - Intergenic
1046720033 8:117608817-117608839 AGCCCTTATGAATAAGCATGTGG - Intergenic
1048088039 8:131205476-131205498 GGCCCTTTTGTAAAATCATCAGG + Intergenic
1048876312 8:138839255-138839277 TGCCATCATGAACAAGCATCTGG + Intronic
1049933455 9:477939-477961 AGCCCTTAAGATCAACCCTCTGG + Intronic
1186264747 X:7820074-7820096 GGCCATTATGGAAAACCATATGG - Intergenic
1195604188 X:106783862-106783884 GGCTCTTTTAAACAACCAGCGGG + Intronic
1195618632 X:106931991-106932013 GGCTCTGATGAGCCACCATCTGG + Intronic