ID: 986435292

View in Genome Browser
Species Human (GRCh38)
Location 5:7723400-7723422
Sequence TGGGATGTTCAAGCTAATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 104}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986435285_986435292 12 Left 986435285 5:7723365-7723387 CCAGTTGAAAGTGCCCTGTGGGA 0: 1
1: 0
2: 0
3: 14
4: 118
Right 986435292 5:7723400-7723422 TGGGATGTTCAAGCTAATCATGG 0: 1
1: 0
2: 0
3: 2
4: 104
986435283_986435292 13 Left 986435283 5:7723364-7723386 CCCAGTTGAAAGTGCCCTGTGGG 0: 1
1: 0
2: 1
3: 10
4: 138
Right 986435292 5:7723400-7723422 TGGGATGTTCAAGCTAATCATGG 0: 1
1: 0
2: 0
3: 2
4: 104
986435288_986435292 -2 Left 986435288 5:7723379-7723401 CCTGTGGGATGGTCTAGTTCCTG 0: 1
1: 0
2: 0
3: 4
4: 182
Right 986435292 5:7723400-7723422 TGGGATGTTCAAGCTAATCATGG 0: 1
1: 0
2: 0
3: 2
4: 104
986435281_986435292 14 Left 986435281 5:7723363-7723385 CCCCAGTTGAAAGTGCCCTGTGG 0: 1
1: 0
2: 0
3: 18
4: 186
Right 986435292 5:7723400-7723422 TGGGATGTTCAAGCTAATCATGG 0: 1
1: 0
2: 0
3: 2
4: 104
986435287_986435292 -1 Left 986435287 5:7723378-7723400 CCCTGTGGGATGGTCTAGTTCCT 0: 1
1: 0
2: 1
3: 4
4: 113
Right 986435292 5:7723400-7723422 TGGGATGTTCAAGCTAATCATGG 0: 1
1: 0
2: 0
3: 2
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986435292 Original CRISPR TGGGATGTTCAAGCTAATCA TGG Intronic
907599200 1:55749830-55749852 TGGGATGTTGAAGGTGATGAAGG + Intergenic
913461343 1:119089242-119089264 TCTCATGTTCCAGCTAATCATGG + Intronic
921594971 1:217044930-217044952 TGAGATATTAAAACTAATCACGG + Intronic
923335859 1:232969641-232969663 TGGGATGTTCAAGGAAGTAACGG - Intronic
1065355952 10:24841983-24842005 TGAGATGTTCTAGCAAATTATGG - Intergenic
1072910546 10:99497134-99497156 TAGGATCTTCAAGGAAATCAGGG + Intergenic
1088653592 11:111978252-111978274 TAGGACTTTTAAGCTAATCAGGG + Intronic
1090546861 11:127774988-127775010 TTGGATGTTTAAGGGAATCATGG + Intergenic
1096027546 12:48380148-48380170 TGGGAAGTTCAAACTATGCATGG - Intergenic
1097412128 12:59268198-59268220 TGGGATGATCAAGCTTAGTAGGG + Intergenic
1098764106 12:74462910-74462932 AAGGATTTTCAACCTAATCATGG + Intergenic
1101838885 12:108313644-108313666 TGGAATGTCCCAGCCAATCAGGG + Intronic
1103210242 12:119160399-119160421 TGGGAGGTTCTGGTTAATCAGGG - Exonic
1103431843 12:120894429-120894451 TTGGAAGGTCAAGCTAAACAAGG + Intronic
1106865378 13:33958822-33958844 TGGGAAGTGCCAGGTAATCATGG - Intronic
1107036507 13:35907748-35907770 TCAGAGGTTCAAGCTAAGCATGG + Intronic
1112979127 13:105359607-105359629 TGGGATGTTCCTGATAATTAAGG - Intergenic
1114434236 14:22690807-22690829 TGGGATTTTCAAGAGCATCAAGG - Intergenic
1114898635 14:27027317-27027339 AAGGATGTTCAAGCTATTGAAGG - Intergenic
1115300413 14:31879130-31879152 TGGGCTCTTCCAGCTAATAAAGG - Intergenic
1116260722 14:42621704-42621726 TGGGTTGTTCTAGGAAATCAAGG - Intergenic
1117980335 14:61336689-61336711 TTGGATATTCAAACTAACCAAGG - Intronic
1120312279 14:82844602-82844624 TGGCAAGTTCTAGCTAATCAAGG - Intergenic
1121507554 14:94488319-94488341 TGGGAGGTTCAAGCCAGTCTGGG - Intronic
1122536703 14:102469715-102469737 AGGGAAGTTCAACCTAATAAAGG - Intronic
1124429398 15:29593387-29593409 GGGGATGTTGAAGTTACTCAGGG - Intergenic
1125086883 15:35740409-35740431 TGGAATCTTCAAGGTAAGCAAGG - Intergenic
1130799488 15:87247114-87247136 TGAGATCTTTAAGCAAATCAGGG + Intergenic
1138973253 16:62171357-62171379 TGGGAAGTTCAGGGTCATCAAGG + Intergenic
1145964952 17:28910414-28910436 TGGAATGTGGAAGCAAATCAGGG + Intronic
1153854040 18:9127429-9127451 TGTGATGCTTAAACTAATCATGG + Intronic
1154136085 18:11779563-11779585 TAGGATGGTCAAGCTTATCTTGG - Intronic
1157192651 18:45594337-45594359 TGTGAGGTTCAAGGGAATCAGGG + Intronic
1158485245 18:57860414-57860436 TGGGATGTTCAAGATTTCCAAGG - Intergenic
1158899610 18:61950366-61950388 TGGGATGCTTAAGCAAAACAGGG + Intergenic
1161328282 19:3673694-3673716 TGGGTTGTTCCAGCGAATGAGGG - Intronic
1161597952 19:5161745-5161767 TTGAATTTTCTAGCTAATCAAGG - Intronic
1165124134 19:33582053-33582075 TGGGAAGTTCAAGATCAACAAGG - Intergenic
1168364856 19:55777605-55777627 TGGGGTTTTCAAGATAATCCAGG - Intergenic
926759794 2:16268360-16268382 TGGCATGTCCAGGCTAATGAGGG - Intergenic
926853351 2:17225570-17225592 TGGAAAGTTCCAGCTAAGCATGG + Intergenic
929322713 2:40564860-40564882 TAGAATGTTCAAGCTCTTCATGG - Intronic
930734477 2:54762361-54762383 GGTGATGTTCAATCTGATCATGG + Intronic
933311780 2:80669638-80669660 TGGGATTATTAACCTAATCATGG + Intergenic
933434405 2:82228117-82228139 TAGGAGTTTCAAACTAATCAGGG - Intergenic
938607124 2:132906613-132906635 TGGGAAGTTCAAACTAAGCAAGG - Intronic
940588347 2:155686086-155686108 TGAAATGTTCAAACTAAGCAAGG - Intergenic
941913565 2:170791285-170791307 TGGTATGTTAAACCTAAACATGG - Intronic
943886982 2:193231358-193231380 TGGGATTCTCAAGGTAATGATGG - Intergenic
944383982 2:199143606-199143628 TGGGAAGGGCAAGGTAATCACGG + Intergenic
946092818 2:217246007-217246029 TGGGATGTTCAAGGCACCCAAGG - Intergenic
946579699 2:221114975-221114997 TGGGAAGTGAAAGCTAAACAAGG - Intergenic
1173110714 20:40185932-40185954 TAGGATTTTCAACATAATCATGG + Intergenic
1173311087 20:41896617-41896639 TGAGTTGATCAAGCTAATCTTGG + Intergenic
1175766463 20:61596001-61596023 TGGAATGTGCAAGCTTGTCATGG + Intronic
1178613194 21:34105220-34105242 TGGGATGTCCAAGCAAAGAACGG - Exonic
1179590531 21:42405180-42405202 TGTTATGTTCAAGCTAAGCCAGG + Intronic
949203729 3:1412804-1412826 TGGTATGTTCTAGTTACTCAAGG + Intergenic
951459458 3:22933679-22933701 TGGGATGTTTAACCTGAGCAAGG - Intergenic
957303580 3:78425947-78425969 TGGACTGTTCAAGATAATCCAGG + Intergenic
958903942 3:99921475-99921497 TGTGATGTTCAGGCAAAGCAAGG + Intronic
961497099 3:127301636-127301658 TGGGAGGTTCCAGTTAAGCAAGG - Intergenic
966251078 3:177866000-177866022 TGGGATGATCGAGCTAGTTAGGG + Intergenic
967963621 3:194943749-194943771 TGGGATGGTGAAGCTCCTCAGGG - Intergenic
968522282 4:1039465-1039487 AGGGGTGTTCAATCAAATCAAGG - Intergenic
971098813 4:23439253-23439275 AGAGAAGTTCAAGCTAGTCACGG - Intergenic
972937975 4:44162750-44162772 TGGGATTTTCCAGCAAACCATGG - Intergenic
979489020 4:121303273-121303295 TGAGATGTCCCAGCTAAGCAGGG - Intergenic
980816623 4:137954973-137954995 TGCGTTGTTCAAGGTATTCAAGG - Intergenic
981821232 4:148889664-148889686 TTGGAAATTCAAGCTAATGAGGG + Intergenic
986435292 5:7723400-7723422 TGGGATGTTCAAGCTAATCATGG + Intronic
987818116 5:22930303-22930325 TGGAAATTTCTAGCTAATCAAGG + Intergenic
988239121 5:28586073-28586095 TGTGATTTAAAAGCTAATCAAGG + Intergenic
990667177 5:58086213-58086235 GGGGATGCTTCAGCTAATCATGG + Intergenic
991301107 5:65130066-65130088 TGGGAAGTCCAAGATCATCAAGG + Intergenic
992212472 5:74494353-74494375 AGGGCTGGTCCAGCTAATCAGGG - Intergenic
992713682 5:79487344-79487366 TTGTATGTTCAAGTTGATCATGG - Intronic
994073346 5:95624776-95624798 TTCCATGTTCAAGCCAATCATGG - Intergenic
994250176 5:97526965-97526987 TGGGCTGTTCAAGCTAACAGTGG - Intergenic
994250540 5:97531729-97531751 TGCTATGTTGAAACTAATCAGGG - Intergenic
997364618 5:133317991-133318013 TGGGCTGTCCAGGCTTATCAAGG - Intronic
997889488 5:137662654-137662676 TTGGATGTTCACTCTACTCAAGG + Intronic
999881633 5:155871155-155871177 GAGGCTGTTCATGCTAATCAAGG + Intronic
1008465046 6:51821029-51821051 TGGGAAGTACAAGCCAAGCAAGG - Intronic
1015708134 6:136110301-136110323 TGGGCTGTTCCAGCTACCCACGG + Intronic
1017345417 6:153373771-153373793 TGGCATGTCCAAGGGAATCAAGG - Intergenic
1022457180 7:30567692-30567714 TGGGATGTTGAAGGTAATACTGG - Intergenic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1025738191 7:64173620-64173642 GGGGATCTTCAAGCTGATTAAGG + Intronic
1026883739 7:73923920-73923942 TAGGATGGTCAAGCTAAAAAAGG - Intergenic
1028478012 7:91272755-91272777 TGGAATGGCCAAGATAATCAAGG - Intergenic
1029333895 7:99883637-99883659 TGGGATGGCCAGCCTAATCACGG - Intronic
1029900287 7:104032131-104032153 TGGTAAGGTAAAGCTAATCAGGG - Intergenic
1034484120 7:151346808-151346830 TGAGTTGTTCTAGCAAATCATGG + Intronic
1034579732 7:152032075-152032097 TTGAATTTTCTAGCTAATCAAGG - Intronic
1045152972 8:99429988-99430010 TGGGATTTTCAAGCAAAGTATGG - Intronic
1047914548 8:129567994-129568016 TGGGATGATCCCGCAAATCAAGG + Intergenic
1051957026 9:22708155-22708177 TGAGATGTTTAAGATACTCAAGG - Intergenic
1052257057 9:26469618-26469640 TGGGATGTTACAGTTAAACAAGG - Intergenic
1056392548 9:86153087-86153109 TTGGACTTTCTAGCTAATCAAGG - Intergenic
1056849612 9:90071334-90071356 TGGGAAGTCCAAGATAAACAGGG + Intergenic
1186761120 X:12723002-12723024 TTGGATGTTCCAGAAAATCAGGG + Exonic
1188051650 X:25494832-25494854 TGATATGTTCATGGTAATCAAGG + Intergenic
1188097760 X:26044310-26044332 TTGAATTTTCTAGCTAATCAGGG + Intergenic
1189549213 X:42075787-42075809 AGAGATGTTCAAGGTGATCAGGG + Intergenic
1191115397 X:56847026-56847048 TGGGATGATCAAGCTTAGTAGGG + Intergenic
1200800800 Y:7385701-7385723 TTGAATTTTCTAGCTAATCAAGG - Intergenic