ID: 986438135

View in Genome Browser
Species Human (GRCh38)
Location 5:7755325-7755347
Sequence CTGGTCCTGCGTCTCCCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986438129_986438135 -3 Left 986438129 5:7755305-7755327 CCAAGAAGTGAACCCGGAACCTG 0: 1
1: 0
2: 3
3: 11
4: 121
Right 986438135 5:7755325-7755347 CTGGTCCTGCGTCTCCCTCAGGG 0: 1
1: 0
2: 1
3: 13
4: 197
986438128_986438135 -2 Left 986438128 5:7755304-7755326 CCCAAGAAGTGAACCCGGAACCT 0: 1
1: 0
2: 0
3: 3
4: 159
Right 986438135 5:7755325-7755347 CTGGTCCTGCGTCTCCCTCAGGG 0: 1
1: 0
2: 1
3: 13
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986438135 Original CRISPR CTGGTCCTGCGTCTCCCTCA GGG Intronic
903390176 1:22958553-22958575 CTGGCCCTACGTCCCTCTCATGG - Intronic
904267150 1:29324753-29324775 CTGGTCCTGCTCCTCCCTCTGGG + Intronic
904425862 1:30422561-30422583 CTGGTCCTGCAGTGCCCTCAGGG + Intergenic
905339193 1:37266653-37266675 CTGGTTCTGAGTCTCTCTGAAGG - Intergenic
905941517 1:41867047-41867069 CTGGCCCTGGCTCTCCATCATGG - Intronic
906459410 1:46025837-46025859 CTTGTCCAGGGTCTCCCTCTTGG + Intronic
908170326 1:61497856-61497878 CTGGAACTGGGTCTTCCTCAGGG + Intergenic
915899297 1:159834880-159834902 CTGGTTCTGGCTCTGCCTCATGG + Exonic
916486749 1:165266347-165266369 CTGGTCCTACTTCTACCTCAGGG - Intronic
918151234 1:181799497-181799519 CTGTTTCTCTGTCTCCCTCATGG - Intronic
919887104 1:201942523-201942545 CTTGGCCTGCTTCTCCCTCCAGG - Intronic
920283315 1:204860262-204860284 CTGTTCCTGCTTCTCCCTGCAGG + Intronic
920869007 1:209777627-209777649 ACAGTCCTGCCTCTCCCTCAAGG - Intronic
921398571 1:214694721-214694743 CTGGCCCTGTTTCTCCCACAAGG - Intergenic
922100583 1:222474467-222474489 CAGGTCCAGCTCCTCCCTCACGG - Intergenic
922465406 1:225843007-225843029 CTGGTCCTGTGTGTCACTGAAGG - Intronic
924173867 1:241369508-241369530 CTGAGGCTGCCTCTCCCTCATGG + Intergenic
924428737 1:243978531-243978553 CTAGTCCAGTGTCTGCCTCATGG - Intergenic
1067037747 10:42932401-42932423 CTGCTGCTGCTTCTCCCTCCCGG - Intergenic
1068512266 10:57981714-57981736 CTGGTTCTGGGTCTCTCTCAAGG - Intergenic
1068953388 10:62800748-62800770 CTGCACCTGCATCTCCCTCCAGG + Intergenic
1069435509 10:68378592-68378614 CTGGTCCTGCGTGTCACTGCTGG + Intronic
1069634985 10:69919658-69919680 CTGCTCCTGGGTCTCCCTTTGGG - Intronic
1071863377 10:89699454-89699476 CTGGCTCTGCATCTCCCTAAGGG + Intergenic
1074275983 10:112002532-112002554 CCGGTCCTGCGACCCCCTCCTGG + Intergenic
1075838842 10:125479785-125479807 AGGATCCTGCGTCTCCCTCCTGG + Intergenic
1076345091 10:129774231-129774253 CTGGACCTGAGGCTCCCTGAAGG - Intergenic
1076361845 10:129895084-129895106 CTTGTTCTGCTTCTTCCTCATGG + Intronic
1077164998 11:1130927-1130949 CTGGGCCTGTGGCTCCCTGAGGG - Intergenic
1078162824 11:8856657-8856679 CTGGGCCTGCCTTTCCATCAGGG - Intronic
1078877566 11:15413438-15413460 CTGGGCCTGTGTCTCCGTCAGGG + Intergenic
1079083693 11:17430756-17430778 CAGGTCCTGTGTCAGCCTCAAGG - Intronic
1079912835 11:26332216-26332238 CTGTTCCTCCGCCTCCCTCTCGG + Exonic
1080197519 11:29629877-29629899 TTGGTCTTGCTTCTGCCTCATGG - Intergenic
1084331326 11:68432317-68432339 CCGGTCCTCCGTGTCCCCCATGG + Intronic
1088808070 11:113369906-113369928 TTGGTCCTCCGTCTCACTGAAGG + Intronic
1089651910 11:119920164-119920186 CTGGGCCTCAGTTTCCCTCAGGG - Intergenic
1089680779 11:120117772-120117794 CTGGTCCTGCCTTTCCCAAAGGG + Intronic
1095651208 12:44611671-44611693 TTGGTTCTGCCTCTCCCACAGGG - Intronic
1103084136 12:118048925-118048947 CTGGGCTTGCATCTCCCTAAGGG - Intronic
1105445125 13:20447382-20447404 CTTTTCCTGCCTCTCCCCCAGGG - Intronic
1106330595 13:28735805-28735827 CTTCTCCTGCGTTTCACTCAAGG - Intergenic
1107879683 13:44822143-44822165 CAGGTCCAGCGCCCCCCTCAAGG - Intergenic
1109336596 13:61002954-61002976 ATAGGCCTGGGTCTCCCTCAAGG + Intergenic
1114128069 14:19754335-19754357 CTTGTCCAGCATTTCCCTCAGGG + Intronic
1119634306 14:76261634-76261656 CTGGTCCAGCGCATCCCTCCGGG - Intergenic
1121529169 14:94640627-94640649 CTGGTCCTGGGCCCCCCTTAGGG - Intergenic
1122122391 14:99561464-99561486 CTGGTACTTGGTCTCCCTCCAGG + Intronic
1122280574 14:100619956-100619978 CTGGACCAGCCTTTCCCTCAGGG - Intergenic
1122874789 14:104659114-104659136 CTGGGCCTGCATATCCCTCCCGG - Intergenic
1123135237 14:106021831-106021853 GTGGTCTTGAGTCCCCCTCACGG + Intergenic
1125834533 15:42737424-42737446 CGGGTCCTGGGTCTCCCTAGAGG - Intergenic
1126100457 15:45115489-45115511 CTGGTCCTGGTTCTGCCTCCTGG - Intronic
1126356674 15:47803354-47803376 CTGGTCCTGTGCCTGGCTCATGG + Intergenic
1129385265 15:75192778-75192800 CTGGTCCTGGGTTTCTCTCTGGG + Intergenic
1129457436 15:75683283-75683305 CTAGTCCTGTGTGTCCCTCAAGG + Intronic
1129726355 15:77903662-77903684 CTAGTCCTGCGTGTCCCTCAAGG - Intergenic
1130361027 15:83186123-83186145 CTGGCTCTGGGTCTCCCACAAGG - Intronic
1131013726 15:89040691-89040713 TCAGCCCTGCGTCTCCCTCAGGG - Intergenic
1131156820 15:90080669-90080691 GTGGTCCTGGGCCTCCCCCAAGG - Exonic
1131594611 15:93784349-93784371 CTGGCCCTGCCTCTTCCTCCAGG - Intergenic
1132644453 16:992395-992417 CTGGGCCTGCGAGACCCTCATGG + Intergenic
1138528246 16:57620946-57620968 CTGCCCCTGCCTCTCCTTCATGG - Intronic
1139306835 16:65993764-65993786 CTCATGCTGCCTCTCCCTCAAGG + Intergenic
1139839721 16:69868501-69868523 CAGGTCCTGCAGCTCCCTGAGGG + Intronic
1140443101 16:75001489-75001511 CATGTCCTGCTTCTCACTCAGGG - Intronic
1140814183 16:78605277-78605299 CTCTTCCTCTGTCTCCCTCATGG + Intronic
1142292490 16:89199454-89199476 CTGGTCCTGCGCCTACTCCACGG - Exonic
1142349378 16:89572936-89572958 CTGGTCCTGGATCTGCCTCGAGG - Intergenic
1143025025 17:3936456-3936478 CTGTTCCAGCATCTTCCTCACGG - Exonic
1143180727 17:4982484-4982506 CTGCTCTTGTGTTTCCCTCAGGG - Intronic
1144857606 17:18278252-18278274 CAGGTCCAGGATCTCCCTCAGGG + Exonic
1144872902 17:18381551-18381573 CTGGGCCTGGGTCTTCCCCAGGG - Intronic
1145237757 17:21221114-21221136 CTGGCCCTGCCCCACCCTCATGG + Intergenic
1146142425 17:30379301-30379323 CAGGCCCCGCGTCGCCCTCAGGG - Exonic
1148571443 17:48672635-48672657 CTGGTCCTGTCACTCCCTAATGG - Intergenic
1149005489 17:51801046-51801068 ATGGACCTGCCTTTCCCTCAGGG + Intronic
1149629431 17:58110134-58110156 CTTGTCCCGGGTCTCCCACAAGG - Intergenic
1150656524 17:67043426-67043448 CTGGTCATGCGTCAGCCTCTCGG + Intergenic
1151748348 17:76023448-76023470 CTGGACCTGGGTCTTCCCCAGGG + Intronic
1152434024 17:80264317-80264339 CAGGTCCTGGGGCCCCCTCACGG - Intronic
1153503524 18:5771825-5771847 CTGGTCGTGCTTATCCCTCCTGG - Intergenic
1155448660 18:25940924-25940946 GGGGTCCTCTGTCTCCCTCATGG - Intergenic
1155734445 18:29203175-29203197 GTGGTCCTCTGTCTTCCTCATGG + Intergenic
1157602326 18:48901890-48901912 CGGGTCCTCCTTCTCCATCAAGG - Intergenic
1158295163 18:55988544-55988566 CTGGTCCTGTTTCTTCCACAAGG + Intergenic
1159446816 18:68551080-68551102 CTGGTTCTCGGTCTCCCACAAGG + Intergenic
1160411940 18:78681065-78681087 CTGGTCCTGTGTGTTTCTCAGGG - Intergenic
1160586176 18:79914813-79914835 CTGTTCCTGAGGCTCCCTCTGGG - Intronic
1161298633 19:3532294-3532316 CTCCTCCTGCTGCTCCCTCAAGG - Intronic
1161468810 19:4446350-4446372 CTGCTCCTCCTTCTCCCGCATGG + Exonic
1161644433 19:5444462-5444484 CCGCTCCTGTGTCTCCCTCTTGG + Intergenic
1161738861 19:6008060-6008082 CAGCTCCTGCGTGTCCCTCCCGG - Intronic
1162019107 19:7860649-7860671 CTTGTCCTGCATCTCCCGAAGGG - Exonic
1163158756 19:15452702-15452724 CTGCTCCTGCTGCTCCGTCAAGG + Exonic
1163466248 19:17470040-17470062 CTGGTCCTGCCTCTACCCCGTGG - Intronic
1164173523 19:22748186-22748208 CTGGTTCTGCGTCTCAATGAGGG - Intergenic
1166500960 19:43340947-43340969 CTGGTCCTGAGACCCCCACAGGG - Intergenic
1166938532 19:46349520-46349542 CTGGTCCTACCTCCCTCTCACGG - Intronic
1167090715 19:47341728-47341750 CTGGCCCTGGGACTCCCTCAGGG - Exonic
1167207643 19:48113367-48113389 CTCTTCCTGTGTCTCCATCATGG - Intergenic
1167751884 19:51385807-51385829 ATCGTCCTGCCTCTCTCTCAGGG + Intronic
1168265865 19:55223728-55223750 CTGGGCCTGCGGGGCCCTCAGGG + Intergenic
1168723668 19:58569332-58569354 CTGGGCCTGAGGGTCCCTCATGG - Exonic
926239526 2:11074453-11074475 CTGGTCCTGGTTCTGCCTCAGGG + Intergenic
927013980 2:18936547-18936569 CTGTTCCTGCCCTTCCCTCAAGG - Intergenic
932583586 2:73008442-73008464 CAGGGCCTGGGTTTCCCTCATGG - Intronic
933775007 2:85766537-85766559 CTGGCCCTGCGTCTCCCCATGGG + Intronic
943113206 2:183633024-183633046 ATGATCCTGCCCCTCCCTCAGGG - Intergenic
945524823 2:210875062-210875084 TTGGTCCTGAGACTTCCTCAGGG + Intergenic
1172776317 20:37409271-37409293 CTGGTCCAGCCTCAGCCTCAAGG + Intergenic
1172797771 20:37554490-37554512 CAGGTCCTGTCTCTTCCTCAAGG + Intergenic
1173721109 20:45258988-45259010 CTGCTCCTGTCTCTTCCTCAGGG - Intergenic
1174338343 20:49880477-49880499 GTGTTTCTGCCTCTCCCTCAGGG - Intronic
1174454574 20:50640178-50640200 CTGGGTCTGCGGCTCCCACAGGG + Intronic
1174472223 20:50769543-50769565 CTGGGTCTGCGGCTCCCACAGGG - Intergenic
1175830804 20:61964841-61964863 CTGGCCCCGCTTCACCCTCACGG + Intronic
1179559878 21:42208832-42208854 CAGGTCCTGCAACTCCCTAAAGG - Intronic
1179712722 21:43272577-43272599 CTGGCCCTGCTGCTCCCTCTTGG + Intergenic
1179973623 21:44850505-44850527 CTGGTGCTCCTTCTGCCTCATGG - Exonic
1179979919 21:44890553-44890575 CTGCTCCTGCGTGCCCCACATGG + Intronic
1180160075 21:45995210-45995232 CTGGTCCTGCGTGCCGCTCACGG + Intronic
1181160710 22:20957975-20957997 GTGATCCTGCGCCTCCCTCAGGG - Intergenic
1181361715 22:22342994-22343016 CAGGTGCTGCGTCACACTCAGGG - Intergenic
1181622468 22:24100490-24100512 CTGTTCCTGCTTCTCCTTCCTGG + Intronic
1182108448 22:27705678-27705700 CTGGTCCACCTTCTCCCTAAGGG - Intergenic
1182257647 22:29050124-29050146 CGGGCCCTGCCTCTCCCTCGGGG + Exonic
1184149009 22:42627823-42627845 CTGCTCCTGCACCTTCCTCATGG - Intronic
1184531903 22:45061589-45061611 CTGGTCCTGCTTCTGGCTGACGG - Intergenic
1184987258 22:48144376-48144398 CTGCTCCTGCATCTCCCTGCAGG - Intergenic
1185196468 22:49473553-49473575 CTGGTTCTGCTCCTCCCCCAGGG + Intronic
950161272 3:10763044-10763066 CTGGCCCTGGGTCTCCCAGATGG - Intergenic
953670481 3:44958133-44958155 CTGTTCCTGCGCATGCCTCAGGG - Intronic
958605338 3:96350861-96350883 CTGGTCCTGTGTTTCTCTAATGG - Intergenic
960162962 3:114370485-114370507 CTGATCCTTCCTCTCCCTGATGG + Intronic
961326120 3:126110438-126110460 CTGGTCCTGCACCAGCCTCATGG + Intronic
961714926 3:128851738-128851760 CTCCTCCTGGGTCTCCCACATGG + Intergenic
963071892 3:141311524-141311546 CTGCCCCTGCGTCCCCATCATGG + Intergenic
964707247 3:159632430-159632452 CTGGGACTCCCTCTCCCTCAGGG + Intronic
969593388 4:8134311-8134333 ATGGTGCTGCGTCTCCCTGTTGG + Intronic
969658388 4:8510830-8510852 AAGGTCCTGGGTCTGCCTCAGGG + Intergenic
973145705 4:46822994-46823016 CTGGTCCTGCTTCTCCATGCAGG - Intronic
973236824 4:47914545-47914567 CTGACCCTGCGTCTCCCGCCGGG + Intronic
977132806 4:93264665-93264687 TTGGTCCTGAGTCCCCCACAAGG + Intronic
978520442 4:109609870-109609892 CTGGACCTGCTTCGCCCTCGGGG - Intronic
979822798 4:125194272-125194294 CAGGTCCTGCTTCTCCCTGCAGG - Intergenic
982178449 4:152728283-152728305 CTGCTCCTTCGGGTCCCTCAAGG - Intronic
982266774 4:153544926-153544948 CTGGCCCTGCCTCTCACTCTGGG + Intronic
983216940 4:165010742-165010764 CTGGTTGTGCTTCTCCCACAGGG - Intergenic
983918347 4:173316221-173316243 CTGGTCCTCAGACTCCCTCCAGG + Intronic
985784857 5:1888117-1888139 CTTGCCCTGCCCCTCCCTCAGGG + Intergenic
986031219 5:3894354-3894376 CTGGCCCTGCCCCTCACTCAGGG + Intergenic
986190019 5:5487783-5487805 CAGCTCCTCCTTCTCCCTCATGG - Intronic
986438135 5:7755325-7755347 CTGGTCCTGCGTCTCCCTCAGGG + Intronic
986716571 5:10528634-10528656 CTGTTCCTGCTACTTCCTCAGGG - Intergenic
987071237 5:14338744-14338766 CTCTTCCTGCCTCTCCCTTATGG - Intronic
991350020 5:65711523-65711545 CTGGGCCTGTGGCCCCCTCAGGG - Intronic
995199450 5:109410205-109410227 CTGCTCCCCCATCTCCCTCAGGG + Intergenic
997470451 5:134114522-134114544 CTTGTCCGACGTCTCTCTCAGGG + Intergenic
997695302 5:135856642-135856664 CCGGCCCTGTGTCTCCCTGATGG - Intronic
997807998 5:136938786-136938808 CTGTTCCTGCCTTTCTCTCAGGG - Intergenic
998378162 5:141705035-141705057 CTGGTGCAGCATCTCACTCAGGG + Intergenic
1002530312 5:179840647-179840669 TTGGTCCTGAGTTACCCTCATGG + Intronic
1002702109 5:181131448-181131470 GTCTTCCTGTGTCTCCCTCATGG - Intergenic
1003731688 6:8831578-8831600 TTGGGCCAGCGTCTCCCTTAGGG + Intergenic
1005513121 6:26529956-26529978 CAAGTTCTGTGTCTCCCTCATGG + Intergenic
1006114444 6:31767754-31767776 CTGGTCCTGCCAATCCCTCAAGG - Exonic
1007723820 6:43902215-43902237 CTGGTCCTGAGACTGCCTCCCGG + Intergenic
1015156828 6:130106007-130106029 GTGGTCCTGGGCCTTCCTCATGG + Intronic
1015642597 6:135351850-135351872 CTGGACCTGCGCCTCCTTCCTGG + Intronic
1016921905 6:149303894-149303916 CTGGCTTTGCGCCTCCCTCAAGG - Intronic
1017663061 6:156692386-156692408 CTGGTACAGCGTCTTCCTCAGGG - Intergenic
1019055774 6:169222271-169222293 CTACTCCGGCGTGTCCCTCAAGG - Exonic
1019446936 7:1076270-1076292 CTGGTGGTGCTCCTCCCTCATGG - Intronic
1022493434 7:30838069-30838091 CTGGTCTTGGGGCTCACTCAAGG + Intronic
1022653422 7:32297638-32297660 GTGGTCCTGCTGCTCCCTGAAGG + Intronic
1023555804 7:41421753-41421775 CTGTTCCTGCCTTTCCCTCAAGG - Intergenic
1025130046 7:56370364-56370386 ACGGCCCTGCTTCTCCCTCACGG + Intergenic
1026959695 7:74400476-74400498 CTGGTCCAGCGCATCCCGCAGGG - Exonic
1027245066 7:76361171-76361193 CTTGGGCTGCGTCTCCTTCAAGG + Intergenic
1028181479 7:87730102-87730124 ATGGCCCTGGGTCTCACTCAAGG - Intronic
1030066047 7:105659996-105660018 GTGGTCCTGCCGCTTCCTCAAGG - Intronic
1031260067 7:119507148-119507170 ATGGCCCTGGGTCTCACTCAAGG - Intergenic
1034077778 7:148249334-148249356 CCTGTCCTCCTTCTCCCTCATGG + Intronic
1035628573 8:1091752-1091774 CTGGCCCTGAGTCTCCTCCATGG + Intergenic
1037812836 8:22097075-22097097 ATGGTCCTGCCTCTCCCACTAGG - Intronic
1040704561 8:50110112-50110134 CTGCTCCTGCGTATCTCTTAGGG + Intronic
1043696440 8:83224768-83224790 CTGGCCCTGAGTTTCCCTTAGGG + Intergenic
1046032975 8:108805627-108805649 AAGGTCCTTCGTCTTCCTCATGG + Intergenic
1046271091 8:111898801-111898823 CTGTTCCTGCCTCTCCCCGATGG - Intergenic
1048975754 8:139672242-139672264 CTGGTCCTGCTCCTGCCTCTGGG - Intronic
1049003218 8:139839073-139839095 CAGCCCCTGCCTCTCCCTCAGGG + Intronic
1049336335 8:142088722-142088744 GTGGGCCTGCGTCTCCCACTGGG - Intergenic
1051900994 9:22040065-22040087 CTGGGCCATCCTCTCCCTCAAGG - Intergenic
1052820910 9:33137417-33137439 CTGGTCATGCACCTCCCTCCTGG + Intronic
1053053718 9:34981233-34981255 CTGGTCCTGCTGCTCCCTATGGG + Exonic
1055496475 9:76860120-76860142 CTGGTCCTGAGACTCCCTCCCGG - Intronic
1056756101 9:89382949-89382971 CTGGGGCTGAGTCTCCCGCAGGG - Intronic
1057824318 9:98360451-98360473 CTGTTCCTGTGTCTCCCTGCAGG - Intronic
1060246045 9:121946967-121946989 CTGGTCCTCACTATCCCTCATGG + Intronic
1060372750 9:123089801-123089823 CTGGGCCTGCTGTTCCCTCATGG - Exonic
1060482165 9:124022938-124022960 CTGGGCCCGCCCCTCCCTCATGG + Intronic
1060839250 9:126781338-126781360 CTGGTCCTCCCACTCCCTGAGGG - Intergenic
1061284078 9:129612454-129612476 CTGGTCCTCTGTCTCACTCTAGG - Exonic
1061372583 9:130206037-130206059 CTGGTCTAGCGTCGCCCTGAGGG - Intronic
1061687438 9:132293325-132293347 GTGGTCCTGGGTCTCCTTTAAGG - Intronic
1062665347 9:137668081-137668103 CTGGTCCTGCCTCTTCTCCAAGG - Intronic
1187023919 X:15412903-15412925 CTGGTCCTAGATCTCCCTGAGGG - Intronic
1187606737 X:20892809-20892831 CTGGACCTCAATCTCCCTCAGGG - Intergenic
1193789175 X:85797597-85797619 CTGGCCCTGCCCCTCCCTCTGGG + Intergenic
1195540482 X:106057165-106057187 CTGGTCCTGCCCTTGCCTCATGG - Intergenic
1199783677 X:151084803-151084825 TTGGTCCTGGATCTGCCTCAGGG + Intergenic