ID: 986438138

View in Genome Browser
Species Human (GRCh38)
Location 5:7755328-7755350
Sequence GTCCTGCGTCTCCCTCAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 186}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986438129_986438138 0 Left 986438129 5:7755305-7755327 CCAAGAAGTGAACCCGGAACCTG 0: 1
1: 0
2: 3
3: 11
4: 121
Right 986438138 5:7755328-7755350 GTCCTGCGTCTCCCTCAGGGGGG 0: 1
1: 0
2: 2
3: 8
4: 186
986438128_986438138 1 Left 986438128 5:7755304-7755326 CCCAAGAAGTGAACCCGGAACCT 0: 1
1: 0
2: 0
3: 3
4: 159
Right 986438138 5:7755328-7755350 GTCCTGCGTCTCCCTCAGGGGGG 0: 1
1: 0
2: 2
3: 8
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986438138 Original CRISPR GTCCTGCGTCTCCCTCAGGG GGG Intronic
900119816 1:1043765-1043787 GTCCTGTGCCTCCCTCAGCCTGG + Intronic
900164558 1:1239550-1239572 CTCCTGCTGCCCCCTCAGGGTGG + Intergenic
901739627 1:11333825-11333847 GTCATCCATCTCCCTCAGAGCGG - Intergenic
901987815 1:13090174-13090196 GTCCTGCTTCTTTCTCAGTGGGG + Intergenic
901993997 1:13136593-13136615 GTCCTGCTTCTTTCTCAGTGGGG - Intergenic
902544596 1:17182059-17182081 GGCCTGGGGCTCCTTCAGGGAGG - Intergenic
905365452 1:37448763-37448785 CTGCTGTGACTCCCTCAGGGTGG - Intergenic
906112610 1:43334326-43334348 GTCCTGTGTCTTCTACAGGGAGG - Intergenic
906281557 1:44557924-44557946 GCCCTGCGTCTTCTCCAGGGTGG + Intronic
906349247 1:45043449-45043471 GCCCTGGGTCTTCTTCAGGGTGG + Intronic
906638352 1:47425456-47425478 GACCTGTGTCTCCCTCAAGCAGG - Intergenic
910136599 1:83979307-83979329 GTGCTGAGTCTGCCTCCGGGTGG + Intronic
910309649 1:85808978-85809000 GTGCTGAGTCTCCCTCTGGATGG + Intronic
911633937 1:100213207-100213229 GCCCCGCGTCTGCCTCAGAGGGG + Intronic
912572899 1:110637582-110637604 GTCCTGGGTCTGCCCCTGGGTGG + Intergenic
913066281 1:115258483-115258505 GTGCTGAGTCACCCTCTGGGTGG - Intergenic
915021061 1:152778677-152778699 GTCCTGTGGCTCCCTAAGGCAGG + Intronic
915349527 1:155215683-155215705 GTGGTGTGTCTCCCTTAGGGTGG + Intergenic
916895945 1:169162040-169162062 GTGCTGAGTCTACCTCTGGGTGG - Intronic
917491815 1:175504646-175504668 GTCCTGCTGCTCCCTCAGCATGG + Intronic
922532177 1:226353047-226353069 GTCCTGTGTCTCCCAGAGGACGG - Intergenic
1070312436 10:75283514-75283536 GGCCTGCCTCTTCCTGAGGGTGG + Intergenic
1070371017 10:75781975-75781997 CTCCTGCCTCTCCCTCTGTGGGG + Intronic
1070752481 10:78972474-78972496 GCCCTGCTTCAGCCTCAGGGGGG + Intergenic
1071489753 10:86128269-86128291 GTCCTGCATCTCCCTGGGGTAGG + Intronic
1071858541 10:89649574-89649596 GTGCTGAGTCTGCCTCTGGGAGG + Intergenic
1077391911 11:2304170-2304192 GCCCTGGGCCTCCCTCACGGTGG - Exonic
1078355429 11:10628700-10628722 GCCCTGCCTCTCGCTCTGGGTGG - Intronic
1082816797 11:57514714-57514736 GTCCTGGGTCTCCCTCCACGTGG - Intronic
1083273664 11:61585057-61585079 GTCCTGGGTCGGCTTCAGGGAGG + Intergenic
1084580795 11:70022017-70022039 GTCCTGCTTCTCCCTGGGGTTGG + Intergenic
1084668661 11:70592361-70592383 GTCCTGCCTCTCACTCCGAGTGG - Intronic
1085140997 11:74141695-74141717 GTCCTCTGTTTTCCTCAGGGAGG - Intronic
1085532378 11:77199579-77199601 GTGCTGCGCCTCACTCAGGCTGG + Exonic
1086845911 11:91749405-91749427 GTGCTGAGTCTACCTCTGGGTGG - Intergenic
1087936365 11:104038034-104038056 GACCTGAGGCTCCCTCAAGGTGG - Exonic
1089284188 11:117395130-117395152 CTGCTGCTTCTCCCTCCGGGCGG - Exonic
1090064577 11:123491923-123491945 GGCCAGCTTCTTCCTCAGGGAGG - Intergenic
1094142927 12:27199272-27199294 GTACTGGGTCTGCCTCAAGGAGG + Intergenic
1095982518 12:47981384-47981406 GTCCAACTTCTCCCTGAGGGTGG + Exonic
1096098884 12:48957059-48957081 GTCCTCCGCCTCGCTCAAGGGGG - Intronic
1096603185 12:52745143-52745165 GTCCTGGGCCTCCCTCAGACAGG - Intergenic
1096887369 12:54731275-54731297 CTCCTGCCTCTCCCTGAGGATGG + Intergenic
1097055871 12:56248813-56248835 GCCCTGCCTGTCCCGCAGGGAGG + Exonic
1097271818 12:57780237-57780259 CTCCTTCCTCTCTCTCAGGGGGG + Exonic
1101913664 12:108879799-108879821 GTCCTGACCCTCCCCCAGGGTGG + Intronic
1104860783 12:131922324-131922346 GTCCTGCTGCTGCCACAGGGAGG - Exonic
1106125652 13:26898186-26898208 GTCCTGAGTCTCCCACACGCTGG - Intergenic
1106954860 13:34925379-34925401 GTCCTTCCTCTCCATCAGGATGG - Intergenic
1107050919 13:36048513-36048535 GTCTTGGGTTTCCCTCAGTGTGG + Intronic
1107648762 13:42523003-42523025 GTCCTGCCTTTCACTCAGGATGG + Intergenic
1117329335 14:54697015-54697037 TTCCTGCATCTTCCCCAGGGAGG + Intronic
1120414730 14:84205381-84205403 GGCCTGCCTCTACCTAAGGGAGG - Intergenic
1122968959 14:105144722-105144744 GCCCTGCATCTCCCTCATGCTGG + Intronic
1123058656 14:105584456-105584478 GGCCTGAGACTCCCCCAGGGAGG + Intergenic
1123082985 14:105704682-105704704 GGCCTGAGACTCCCCCAGGGAGG + Intergenic
1123494715 15:20814366-20814388 GCCATGCGTCTCCCTGCGGGCGG + Intergenic
1123551210 15:21383459-21383481 GCCATGCGTCTCCCTGCGGGCGG + Intergenic
1125736281 15:41928733-41928755 ATACTGCTTCCCCCTCAGGGTGG - Intronic
1125760495 15:42093006-42093028 GCCCTGCACCTCCCTCAGGCTGG + Intronic
1128651079 15:69414256-69414278 GTCCTGCCTCTCCCTGCGGACGG + Exonic
1129680177 15:77654455-77654477 GTCCTGGGGCTACCTCAGGCTGG + Intronic
1131285222 15:91051406-91051428 GTCCTGCCTCTCCCTCTGAGCGG + Intergenic
1202959552 15_KI270727v1_random:110702-110724 GCCATGCGTCTCCCTGCGGGCGG + Intergenic
1132644093 16:990858-990880 GCCCGGCTTCTCCCCCAGGGCGG + Intergenic
1132690721 16:1180755-1180777 GGCCTGTGGCTCCCACAGGGAGG + Intronic
1134823878 16:17269015-17269037 GTCCTGAATCATCCTCAGGGAGG + Intronic
1135985161 16:27178746-27178768 GTCCTGCTTCCTCCCCAGGGAGG + Intergenic
1136080855 16:27851871-27851893 TTCCTGCGCCTCCCTCGAGGTGG + Intronic
1136172599 16:28497762-28497784 TTGGTGCCTCTCCCTCAGGGTGG - Exonic
1137271859 16:46907500-46907522 CTCCTGTGTGTCCCTCAGGTCGG - Intronic
1138554305 16:57762951-57762973 CTCCGTCATCTCCCTCAGGGAGG + Intronic
1139003672 16:62544943-62544965 GTCTTGCTTCTTCATCAGGGTGG - Intergenic
1141666734 16:85469674-85469696 GTCCTGCTGCTCCCTGAGGCTGG + Intergenic
1142068797 16:88077939-88077961 GTTCTGCGTCTCCATCGTGGTGG + Intronic
1143512217 17:7403205-7403227 GTGCTGTGTCTCCTTCAGGCTGG - Exonic
1143719436 17:8799331-8799353 GCCCCGCCTCTCCCTCCGGGCGG - Exonic
1144618940 17:16803102-16803124 CTACTGGGTCTCCCTCTGGGTGG - Intronic
1144767367 17:17740019-17740041 GGCCTGTGATTCCCTCAGGGTGG - Intronic
1144893767 17:18512593-18512615 CTACTGGGTCTCCCTCTGGGTGG + Intergenic
1146596357 17:34172547-34172569 GTGCTGAGTCTGCCTCTGGGTGG + Intronic
1146911519 17:36651471-36651493 CTCCTTCTTCTCCCACAGGGTGG + Intergenic
1147625859 17:41899468-41899490 GCCCTGCTTCTCCCTCTGCGTGG + Intronic
1147796406 17:43046643-43046665 CTCCTGCCTCAGCCTCAGGGCGG - Intronic
1148147436 17:45374695-45374717 GCCCTCAGACTCCCTCAGGGCGG + Intergenic
1149355614 17:55836133-55836155 CTCCTACTTCTCCTTCAGGGTGG - Intronic
1152192567 17:78897430-78897452 GTCCTGCGGCTAAGTCAGGGCGG + Intronic
1153587093 18:6633539-6633561 GCCCTGCGTCTCCCCTATGGAGG + Intergenic
1153954700 18:10086439-10086461 GTCCTGTGCCTCCCAGAGGGTGG - Intergenic
1154181857 18:12145238-12145260 GGCCTGCCTCTCCTTCTGGGAGG + Intergenic
1155039306 18:22051700-22051722 TTCCTGCCTCTCCCTGGGGGAGG - Intergenic
1155187671 18:23401687-23401709 GTCCTGGGCCTCCCGCAGTGAGG - Intronic
1155351814 18:24914387-24914409 TTCCTGCTTCTCCCTCTTGGAGG + Intergenic
1156713118 18:39972849-39972871 GTCCTGCATCTGATTCAGGGAGG + Intergenic
1159944803 18:74436513-74436535 CTCCTGCAGCTCCCTCAGTGTGG + Exonic
1160257712 18:77261352-77261374 GTCCTCCGTCTCCGTCAGACGGG - Intronic
1160411939 18:78681062-78681084 GTCCTGTGTGTTTCTCAGGGCGG - Intergenic
1161222396 19:3123632-3123654 GTCCCCCGGCTCCCCCAGGGAGG + Exonic
1161596627 19:5154094-5154116 GACCTGAGCCTCCCTCAGGGAGG + Intergenic
1161660685 19:5544140-5544162 GGCCTCCCTCTCCCCCAGGGAGG + Intergenic
1163161165 19:15464713-15464735 GTGCTGCCTCCCCGTCAGGGAGG - Intergenic
1163166001 19:15498785-15498807 GTCCTGAGGCTCCAACAGGGAGG - Intronic
1163607809 19:18284906-18284928 GTCATGCCTCTCCCTGAGGCAGG + Intergenic
1166345662 19:42163628-42163650 GTCCCTGGCCTCCCTCAGGGAGG - Intronic
1166391613 19:42411697-42411719 GTCTTGCTTCTCCCCCAGTGGGG + Intronic
1167207686 19:48113608-48113630 GTCCTGATACTCCCGCAGGGGGG - Intergenic
926239527 2:11074456-11074478 GTCCTGGTTCTGCCTCAGGGTGG + Intergenic
930373217 2:50531251-50531273 GTCCTGCGTCTAGCTCCAGGCGG + Exonic
932246789 2:70203038-70203060 GTCCTGTGGCTCCCTATGGGAGG - Intronic
933846045 2:86328100-86328122 ATCCTGCAACTCCCTCAGGAGGG + Intronic
938959461 2:136328299-136328321 TTCCTGCGTTTGCCTCTGGGAGG + Intergenic
941960167 2:171245620-171245642 GTGCTGAGTCTGCCTCTGGGTGG - Intergenic
948291977 2:236832368-236832390 GGCCTGCTTCTCCCTCACTGGGG - Intergenic
948696788 2:239736851-239736873 GTCCTGCCTTGTCCTCAGGGTGG - Intergenic
948947268 2:241227118-241227140 CACCTGGGTCTCCCTCAGTGTGG + Intergenic
949024383 2:241759248-241759270 GACCTGCCACTCCCTGAGGGAGG + Intronic
1168945135 20:1748120-1748142 GTCCAGCCTCTGCCCCAGGGAGG - Intergenic
1169131505 20:3168322-3168344 GGCCTGCGTTTCCCACAGGTGGG + Intronic
1175660119 20:60805063-60805085 GATCTGCGTCTCCCTCAGGGTGG - Intergenic
1175915807 20:62425222-62425244 GACCTGCGCCTCCCTCATGTGGG + Intronic
1176169058 20:63688979-63689001 GACCTGGGTCTCCCTCATGGGGG + Intronic
1179668706 21:42930459-42930481 GTGCTGAGTCTGCCTCTGGGTGG - Intergenic
1181582688 22:23836895-23836917 GTCCTGGCTGTTCCTCAGGGAGG + Intronic
1183733738 22:39632137-39632159 CTCCTGCTTCTCCCTCGGGCCGG - Intronic
949341181 3:3032715-3032737 GGTCTGCTTCTCCCTCAGGAAGG - Intronic
950626491 3:14251244-14251266 GTGCTGAGTCTGCCTCTGGGTGG + Intergenic
954135358 3:48579802-48579824 GTCCTGTGTCTACCTGTGGGGGG + Exonic
954606785 3:51917161-51917183 GCCCTCCCTCTCCCTCAGGAGGG + Intergenic
955572500 3:60323177-60323199 GCCCTGCGTCCCCTTGAGGGAGG - Intronic
960662788 3:120079188-120079210 CTCCTCAGTCTCCCTCTGGGAGG + Intronic
961452363 3:127008160-127008182 GTCCTTCGTGACACTCAGGGAGG + Intronic
966152169 3:176877113-176877135 GGCCTGCCCCTCCCTCTGGGGGG - Intergenic
968644481 4:1732731-1732753 GTCCGGCGTCTCCCTCGGGGAGG + Intronic
971483680 4:27138397-27138419 TTCATGCCTCTCCCTCTGGGTGG + Intergenic
972683009 4:41325072-41325094 GTGCTGTGTCTACCTCTGGGTGG + Intergenic
976322083 4:83727584-83727606 GTACTGAGTCTGCCTCTGGGAGG + Intergenic
980829153 4:138108727-138108749 GTGCTGAGTCTGCCTCTGGGTGG - Intergenic
982109558 4:152041392-152041414 CTCCAGCGTCTCCCTCCTGGTGG + Intergenic
985774499 5:1833826-1833848 GCCCTGCCTGTCCCTCCGGGTGG + Intergenic
986438138 5:7755328-7755350 GTCCTGCGTCTCCCTCAGGGGGG + Intronic
1006837078 6:37005552-37005574 GCCCCACCTCTCCCTCAGGGGGG - Intergenic
1006924025 6:37644381-37644403 GGGCTGCGTCTCCCTCAGACTGG + Intronic
1007159294 6:39775681-39775703 GTCCTGCTTCTGCCTCAGCAAGG - Intergenic
1007256974 6:40536275-40536297 GGGCTGTGTCTCCCTCAGAGTGG - Intronic
1007707119 6:43797894-43797916 GGGCTGTGTCTCCCTCAGAGTGG - Intergenic
1007707181 6:43798124-43798146 GGGCTGCGTCTCCCTCAGACTGG - Intergenic
1007750071 6:44066200-44066222 GGGCTGCGTCTCCCTCAGACTGG + Intergenic
1008643102 6:53484829-53484851 TTCCAGCATCTCCCTCATGGTGG - Intergenic
1009741140 6:67747722-67747744 GTACTGCTTCTCCCACAGGCAGG + Intergenic
1011022819 6:82833270-82833292 GCCCTGAGTCTGCCTCTGGGTGG + Intergenic
1014773307 6:125481291-125481313 GTTCTCCCTCTCCCACAGGGAGG - Intergenic
1015173129 6:130276901-130276923 GTGCTGAGTCAGCCTCAGGGTGG + Intronic
1019055773 6:169222268-169222290 CTCCGGCGTGTCCCTCAAGGTGG - Exonic
1019527643 7:1487861-1487883 CTCCTGCTTCTCCCGCTGGGCGG + Exonic
1019937409 7:4265390-4265412 GCGCCGCGCCTCCCTCAGGGCGG + Exonic
1022199400 7:28102048-28102070 GCCCTGCCTCCCACTCAGGGTGG - Intronic
1023401088 7:39793316-39793338 GCCCTGCTCCTCCCTCACGGTGG - Intergenic
1023696646 7:42854738-42854760 CTCCAGAGTCTCCCTCAGGTGGG + Intergenic
1023770230 7:43550387-43550409 GTTCTGCTTATCTCTCAGGGAGG - Intronic
1023806726 7:43877768-43877790 GTACTGCTTCTCACTCAAGGAGG + Exonic
1023865171 7:44235016-44235038 GTCCTGAGTTCCCATCAGGGAGG - Intronic
1024075071 7:45813976-45813998 GCCCTGCTCCTCCCTCACGGTGG - Intergenic
1024648523 7:51387365-51387387 GCCCTGCTCCTCCCTCACGGTGG + Intergenic
1024853183 7:53744731-53744753 TTCATGCGACTCCCTCAGGCAGG - Intergenic
1025052373 7:55741833-55741855 GTCCTGCTCCTCCCTCACAGTGG + Intergenic
1025052765 7:55743381-55743403 GTCCTGCTCCTCCCTCACGGTGG + Intergenic
1025129333 7:56367516-56367538 GCCCTGCTCCTCCCTCACGGGGG + Intergenic
1025130047 7:56370367-56370389 GCCCTGCTTCTCCCTCACGGTGG + Intergenic
1025130353 7:56371617-56371639 GCCCTGCTCCTCCCTCACGGTGG + Intergenic
1025130673 7:56372915-56372937 GCCCTGCTCCTCCCTCACGGTGG + Intergenic
1025130989 7:56374208-56374230 GGCCTGCTCCTCCCTCACGGTGG + Intergenic
1025850519 7:65239838-65239860 GTCCTCAGTCTCCCAGAGGGTGG + Intergenic
1029123175 7:98281670-98281692 GCCCCGCGTCTGCCTCAGAGGGG + Exonic
1029620072 7:101684841-101684863 GGCCTGGGTGTGCCTCAGGGTGG - Intergenic
1031832538 7:126645390-126645412 GTGCTGAGTCTTCCTCTGGGTGG - Intronic
1034637320 7:152577510-152577532 GTGCTGAGTCTGCCTCTGGGTGG + Intergenic
1034686722 7:152978287-152978309 GTGCTGAGTCTGCCTCTGGGTGG + Intergenic
1035459336 7:159029636-159029658 GCTCTGCGGCTCCCACAGGGCGG + Exonic
1037822833 8:22143400-22143422 GTCCTGGGTCTCCCTGAAGGAGG + Intergenic
1038577434 8:28717201-28717223 GTCCTGCACCGCCTTCAGGGTGG - Exonic
1041271476 8:56113493-56113515 CCCCTGCGTCCCCCTCAGGGTGG + Exonic
1045189254 8:99866764-99866786 TTCCTGCCTGTCCCTCAGTGTGG + Intronic
1045882151 8:107053828-107053850 CTCCTGGGTCTCTCTGAGGGAGG - Intergenic
1047027133 8:120836272-120836294 GTCCTGCAAGTCCCTCAGTGTGG - Intergenic
1047459019 8:125044481-125044503 TTCTTGCCTCTCCCCCAGGGTGG + Intronic
1049306563 8:141907174-141907196 GTCCAGTGCCTCCCTGAGGGTGG + Intergenic
1049664729 8:143837848-143837870 GTCCTGTGTGTCCCTGAGGAGGG - Intronic
1049698107 8:143993479-143993501 GTCCTGTGTCTCCATCAGCAGGG - Intronic
1059452576 9:114379594-114379616 GTCCTGTGACTCCCGCAGGCTGG - Intronic
1060393635 9:123300403-123300425 TTCCTGCCTATCCCACAGGGTGG - Intergenic
1188061459 X:25606483-25606505 GGCCAGCTTCTCCCTGAGGGAGG - Intergenic
1194473164 X:94322832-94322854 GTGCTGAGTCTGCCTCTGGGTGG - Intergenic
1197626029 X:128803467-128803489 GAACTGGGTCTGCCTCAGGGAGG + Intergenic
1197663103 X:129194849-129194871 GTGCTGAGTCTGCCTCTGGGAGG + Intergenic
1199608345 X:149593990-149594012 GGCCTGTGTCCCCCTCTGGGTGG - Intronic
1199630775 X:149775370-149775392 GGCCTGTGTCCCCCTCTGGGTGG + Intronic
1199847882 X:151704230-151704252 GCACTGCGTCTCCCTCAGCCAGG - Exonic