ID: 986438525

View in Genome Browser
Species Human (GRCh38)
Location 5:7758739-7758761
Sequence CCTGCTCGATGGAATCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 77}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986438525 Original CRISPR CCTGCTCGATGGAATCCTGG AGG Intronic
901600492 1:10419768-10419790 CCTGGTCTGTGGAATCGTGGAGG - Exonic
903074205 1:20749837-20749859 CCTGCTTGGTGGAAGCCTGATGG - Exonic
904406004 1:30288297-30288319 CTTCCTCGATGGAACCCTAGAGG + Intergenic
912691867 1:111810684-111810706 CCAGCTCCTTGGAGTCCTGGAGG - Intronic
915592375 1:156878073-156878095 ACTGCTGGATGGAACACTGGGGG + Intronic
1074039717 10:109776258-109776280 CCTGGTCGAGGGAATCTGGGTGG + Intergenic
1083618976 11:64039658-64039680 CCTGCTCCATGGAACCCTCTTGG - Intronic
1086338922 11:85827277-85827299 ACTGCTCCATGGAATCCAGTGGG - Intergenic
1101878073 12:108608492-108608514 CATGCTCGCTTGAACCCTGGAGG + Intergenic
1103242822 12:119429126-119429148 CCTGCTAGCTGGGATGCTGGAGG + Intronic
1104114773 12:125738664-125738686 TCTGCTAGATGTAAACCTGGAGG - Intergenic
1111674202 13:91367071-91367093 CTTGCTTGATGGAATCATCGAGG + Intergenic
1114181537 14:20372157-20372179 CCAGCTCCTTGGATTCCTGGTGG - Intronic
1114631483 14:24162137-24162159 CCTGCCTGATGCCATCCTGGGGG - Exonic
1115477893 14:33833976-33833998 GCTGCTCGATGGAGACCGGGTGG + Intergenic
1119914517 14:78384739-78384761 TGTGCTCCATGGAATCCTGGAGG - Intronic
1120373223 14:83665923-83665945 ACTGCTCCATGGAATCCTTTGGG + Intergenic
1126335534 15:47582954-47582976 CCTGCTTCCTGGAATCCTGTGGG - Intronic
1127322696 15:57863192-57863214 CCTGTCCCATGGAAGCCTGGGGG + Intergenic
1129697206 15:77747416-77747438 CCTGCTTGGGGGAACCCTGGAGG - Intronic
1129785103 15:78304608-78304630 ACTGCTCTAGGGGATCCTGGCGG - Intergenic
1132762650 16:1518320-1518342 ACTGCTTGATGGACTCCTTGGGG + Exonic
1134806877 16:17133510-17133532 TCTGCTCAATGGAATACTAGAGG + Intronic
1136643760 16:31590942-31590964 CCTGCTACATGGAATACTTGGGG + Intergenic
1136661843 16:31769824-31769846 CCTGCTACATGGAATACTTGGGG - Intronic
1137751527 16:50864414-50864436 CCTGCTGGATGGAGGCTTGGAGG + Intergenic
1141804310 16:86332663-86332685 CCTGCTGGATGTAAACCTGGGGG + Intergenic
1141832903 16:86519685-86519707 CCTGCTCCCTGGAGTGCTGGCGG - Intergenic
1142326382 16:89417775-89417797 TCTGCTCGTTAGGATCCTGGTGG - Intronic
1142326394 16:89417845-89417867 TCTGCTCGTTAGGATCCTGGTGG - Intronic
1145736284 17:27234181-27234203 CGTGCTCTATGGAACCCTGCAGG - Intergenic
1148805122 17:50260013-50260035 CCTGCTCGGGGGAATCTGGGTGG + Intergenic
1150151492 17:62812593-62812615 CCTGCACAATGGCATGCTGGAGG - Intergenic
1152934148 17:83126245-83126267 CCTGCTCCACTGAATGCTGGGGG + Intergenic
1155656098 18:28194880-28194902 CCAGCACGATGGAGTTCTGGTGG + Intergenic
1155957148 18:31963646-31963668 CCTGGTCTGTGGAATCGTGGAGG - Intergenic
1160805380 19:990240-990262 CCTGGGCGCCGGAATCCTGGAGG - Exonic
1161947124 19:7444379-7444401 CCTCCTCCAGGGACTCCTGGCGG - Exonic
1167117790 19:47498148-47498170 CCTTCTGGAGGGAGTCCTGGAGG + Intronic
1168710503 19:58497414-58497436 CCTGTCCCATGGAATGCTGGTGG - Intronic
926018736 2:9475980-9476002 CCTGCTGGAAGGAAAACTGGAGG - Exonic
930680839 2:54255521-54255543 CCAGCTGGATGGACTCCAGGGGG + Exonic
937311234 2:120904653-120904675 CCTGCCCGATGGAATCCACTGGG + Intronic
947669820 2:231929126-231929148 CCGGCTGGATGGAACCCTGCAGG - Intergenic
947908982 2:233789532-233789554 CCTGCTGGATGATGTCCTGGAGG - Exonic
1173202435 20:40963699-40963721 CCTGCTCAAATGAATCCTGTGGG + Intergenic
1173450596 20:43160145-43160167 CCTGCTCGTTGGTATTCTGGTGG - Intronic
1175760467 20:61559349-61559371 GCTGCTCGTTGGAATGCTGATGG + Intronic
1178345304 21:31821017-31821039 CATCCTAGATGAAATCCTGGAGG + Intergenic
1180179449 21:46111503-46111525 CCTGCTCTGGGGAATCCTGGGGG + Exonic
1183302195 22:37063860-37063882 GCTGCTCGAGGAAATCCTGCCGG + Intergenic
953484923 3:43286420-43286442 GCTGCTGGAGGGCATCCTGGCGG - Intergenic
953755642 3:45643689-45643711 CCTGCTCCATGGGCTTCTGGCGG - Intronic
955200132 3:56844570-56844592 CCTGTTGGCTGGAATCCTGGTGG - Intronic
962477661 3:135770526-135770548 CCTGCTCCCTGGAATCTTGTGGG + Intergenic
965689141 3:171336920-171336942 CATGCTCCCTGGAATCCTAGTGG + Intronic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
970081854 4:12296283-12296305 CCTGCACTCTGGAATCTTGGTGG + Intergenic
971240319 4:24882536-24882558 CCTGCTATCTGGAATCCTGAAGG + Intronic
984807660 4:183766443-183766465 ACAGCTCGAGGGAGTCCTGGAGG + Intergenic
985875096 5:2588315-2588337 CTTGCTGGATGGAATTCTGAAGG + Intergenic
986438525 5:7758739-7758761 CCTGCTCGATGGAATCCTGGAGG + Intronic
992154172 5:73938602-73938624 TCTGCTCGATGGAAATTTGGGGG + Intronic
994088529 5:95786475-95786497 CCTCCTTGATGGAAACCTGAAGG - Intronic
999142757 5:149373472-149373494 CCTGCTCTTTGGCAACCTGGAGG + Intronic
1002108362 5:176891466-176891488 CCTGCTCCATGGAACCCAAGAGG + Exonic
1005271946 6:24175455-24175477 TCTGCTCTATGAAATCCTAGAGG + Intronic
1018839004 6:167505843-167505865 CCTGATCAATGGCAACCTGGAGG - Intergenic
1019511532 7:1419948-1419970 CCTGCTCCGTGCAACCCTGGAGG + Intergenic
1020878560 7:13729458-13729480 CCTGCTTGTTGCAATCATGGGGG + Intergenic
1023335435 7:39164468-39164490 CCTGCTCCATAGAGTCCTGCTGG - Intronic
1023675323 7:42622764-42622786 TGTGCTCGATGGAACCCTGGGGG + Intergenic
1025762072 7:64404650-64404672 CTTGCACCATCGAATCCTGGCGG - Intergenic
1029105417 7:98171164-98171186 CCTGTTCTATGGACTCCAGGCGG - Intronic
1036510373 8:9394447-9394469 TGTGCTCCAGGGAATCCTGGGGG - Intergenic
1037400483 8:18490944-18490966 CCTGCTCGGATGAATCCTGGGGG - Intergenic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1049233088 8:141494354-141494376 CCTGCTTGATGGAGACTTGGGGG - Intergenic
1053053202 9:34978100-34978122 TCTGCTCCATGCTATCCTGGGGG - Exonic
1057431372 9:94997499-94997521 CCTGCACATTGGAATCCTGAGGG + Intronic
1058625898 9:106932361-106932383 CTTGCTTGATGGAATGTTGGAGG + Intronic
1061635050 9:131902485-131902507 CCCGCTCGATACAGTCCTGGTGG - Intronic
1188158161 X:26767825-26767847 CCTCATAGATGGAATCTTGGAGG + Intergenic
1194547843 X:95260247-95260269 CTTTCTCCATGGAATCGTGGTGG - Intergenic
1199627741 X:149756739-149756761 CATCCTGGATGGAATCATGGAGG + Intergenic