ID: 986439469

View in Genome Browser
Species Human (GRCh38)
Location 5:7767047-7767069
Sequence CTGTAGTGGTTAAGAGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 236}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986439469_986439471 5 Left 986439469 5:7767047-7767069 CCTTCTTCTCTTAACCACTACAG 0: 1
1: 0
2: 1
3: 13
4: 236
Right 986439471 5:7767075-7767097 CTAGCATATTTCCTACCATATGG 0: 1
1: 0
2: 1
3: 13
4: 174
986439469_986439474 20 Left 986439469 5:7767047-7767069 CCTTCTTCTCTTAACCACTACAG 0: 1
1: 0
2: 1
3: 13
4: 236
Right 986439474 5:7767090-7767112 CCATATGGCATTCAATTATAAGG 0: 1
1: 0
2: 0
3: 11
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986439469 Original CRISPR CTGTAGTGGTTAAGAGAAGA AGG (reversed) Intronic
900903436 1:5533202-5533224 CTTTCTTGGTTAAGAGAAAATGG - Intergenic
902136583 1:14311478-14311500 CTATAGAGATTTAGAGAAGATGG + Intergenic
902342193 1:15791220-15791242 CTCTAGGGGTTAAGGTAAGAGGG + Intergenic
903707051 1:25294029-25294051 ATCTTGTGATTAAGAGAAGAAGG + Intronic
903720185 1:25399313-25399335 ATCTTGTGATTAAGAGAAGAAGG - Intronic
904195189 1:28780293-28780315 CTGGAGTGGGTAAGAGAAAATGG - Intergenic
908360694 1:63366529-63366551 CTGTAGGAGTTAGGAGAAGAGGG - Intergenic
910489050 1:87747733-87747755 GGGTAGTGGTTAAGAGAATAGGG + Intergenic
910817324 1:91305047-91305069 CTGCAGTGATTAAGACAAGGTGG - Intronic
911799922 1:102122977-102122999 CTGTGGCGGTGAAGAGAGGATGG + Intergenic
913065396 1:115247905-115247927 ATCTAGTGATTAAGAGAGGAGGG - Intergenic
915351654 1:155230582-155230604 CTGAACTGGTTAACAGTAGAGGG - Intergenic
916769149 1:167891325-167891347 CTGTTGTGTTGGAGAGAAGAGGG - Intronic
916950271 1:169772985-169773007 TTGTACTTTTTAAGAGAAGAAGG - Intronic
917104278 1:171476736-171476758 CAGTAGGGGTTGAGAGAAGTAGG - Intergenic
917321155 1:173783012-173783034 CTGTAGTGTTTAAGAGAATTTGG - Intronic
918262963 1:182812880-182812902 GTGAATTGGTTAAGAAAAGAAGG + Intronic
918319940 1:183354802-183354824 CTGTGGTGATTGAGAGAAGTAGG - Intronic
920797598 1:209155453-209155475 GTGGAGTGGGTAAGAGGAGAGGG + Intergenic
920949806 1:210562042-210562064 CTGTAGTGGTTGATACAACAGGG - Intronic
921754218 1:218834750-218834772 CTGTAGTGGGAAAGAGGACATGG - Intergenic
921963481 1:221062270-221062292 CTCTAAAGGTCAAGAGAAGAAGG + Intergenic
922607523 1:226899656-226899678 CTGCAGTGGTTTAAACAAGATGG + Intronic
922907754 1:229187711-229187733 CTGTAGGGATGAAGAGAAGTAGG - Intergenic
923001462 1:230009584-230009606 CAGTAATGGTTAAGAGATTAGGG - Intergenic
923894693 1:238256645-238256667 TTGTAGTGGTGAAGTGCAGAAGG - Intergenic
924094438 1:240536614-240536636 CTGTAGAGTTTAAGACAAAATGG + Intronic
924094445 1:240536665-240536687 CTGTAGAGTTTAAGACAAAATGG + Intronic
924094452 1:240536716-240536738 CTGTAGAGTTTAAGACAAAATGG + Intronic
924939760 1:248804869-248804891 CTGCTGTGGTTTAGGGAAGAAGG - Intergenic
1066315461 10:34241549-34241571 CTGTAGTAGGCAAAAGAAGAAGG + Intronic
1066492495 10:35907108-35907130 CTGGTGTGGTTAAGAGAGAAGGG + Intergenic
1068964653 10:62899740-62899762 CTGTAATTTTTAAGAGGAGAGGG - Intronic
1069481431 10:68785760-68785782 CTGAAGAGGTTCAGGGAAGATGG - Intronic
1069721403 10:70551779-70551801 CTGTTGTGGATCAGAGAGGAGGG + Intronic
1070167248 10:73908113-73908135 CTGTTGAGGGTAAGAGAATAAGG - Intergenic
1073894141 10:108134736-108134758 CTGAAGTGTGTGAGAGAAGAGGG + Intergenic
1078703458 11:13714346-13714368 CTCTAGTAGCTAAGAGAATATGG - Intronic
1079755572 11:24256116-24256138 GAGTAGTGGTTATGAGAAGCTGG + Intergenic
1080048860 11:27837972-27837994 TTGTAGTGGTGAGGAGAACAAGG + Intergenic
1081313907 11:41607411-41607433 CTCTAGAGGACAAGAGAAGATGG + Intergenic
1081757106 11:45552517-45552539 CTGGTGTGGTTAAAAGAACAGGG + Intergenic
1085494547 11:76956036-76956058 CTGGAGGGGTTGAGAGAAAATGG + Intronic
1086557421 11:88127500-88127522 TGGGAGTGGTTAAGAGTAGAGGG + Intronic
1086783176 11:90932110-90932132 AGGTAGTGGTGGAGAGAAGATGG - Intergenic
1088666079 11:112095083-112095105 ATCTTGTGATTAAGAGAAGAAGG - Intronic
1091337034 11:134779708-134779730 CTGTGGGGGTGAAGAGAAAAGGG + Intergenic
1091407968 12:220828-220850 CTGGAGTGGATAAGACAAGAGGG - Exonic
1097242920 12:57588542-57588564 CTGTTGTGTTTGAAAGAAGAGGG - Intergenic
1098260761 12:68668049-68668071 CTGTACTGGTTCAGAGTGGAAGG - Exonic
1099949629 12:89286965-89286987 CTGTAATGGTGAAGAGGTGATGG - Intergenic
1100599062 12:96097309-96097331 CAGTAGTGGTTAAGTGAGAAGGG + Intergenic
1100917112 12:99436876-99436898 CTGTAGAGGTAAAGAAAATAAGG - Intronic
1101557411 12:105823198-105823220 AAGAAGTGGGTAAGAGAAGAAGG + Intergenic
1102540077 12:113612298-113612320 TTAGAGTGGTTAGGAGAAGACGG + Intergenic
1104129659 12:125881104-125881126 CTGGAGTAGTTAAGAGCTGATGG + Intergenic
1105753691 13:23445394-23445416 CTGTAAATGTTAAAAGAAGAGGG + Intergenic
1107112552 13:36713467-36713489 CTATAGTGGTTAACAGAGGCTGG - Intergenic
1107281254 13:38738006-38738028 CTGTTGTGGCAAAGAAAAGAGGG + Intronic
1107328674 13:39273167-39273189 TTCTAATGATTAAGAGAAGATGG - Intergenic
1107355816 13:39565449-39565471 GTGTAGTTGTTAAAATAAGATGG + Intronic
1107676658 13:42804719-42804741 CTTTAATGGTAAAGTGAAGATGG + Intergenic
1107820872 13:44284608-44284630 CTGAAGTTGCTAAGAGAAGCAGG - Intergenic
1108591686 13:51918109-51918131 CTGTGATGGTAAAGAGGAGAAGG - Intergenic
1109593600 13:64520918-64520940 GTGTGGTGGTAAAGAGAAGTTGG - Intergenic
1111995712 13:95164383-95164405 CTGCAGTGTTTAGGAGAATAAGG + Exonic
1114449855 14:22818393-22818415 AGGTAGTGGTTGAGAAAAGAGGG - Intronic
1116883004 14:50190961-50190983 CTCTGGTGGGGAAGAGAAGAGGG - Intronic
1117455335 14:55891271-55891293 CTATAGTTTATAAGAGAAGAAGG + Intergenic
1117636605 14:57751242-57751264 CTGAAGTGGTTAGGAGCACAGGG - Intronic
1119630427 14:76227316-76227338 CTTTTGAGGTTAGGAGAAGAGGG - Intronic
1121404421 14:93710636-93710658 CTGGATTGGATCAGAGAAGATGG + Intergenic
1121838229 14:97110762-97110784 CTGGCGTCCTTAAGAGAAGAGGG - Intergenic
1122169098 14:99856689-99856711 CTGTAGTGATTTATAGAAAAGGG + Intronic
1126262816 15:46714249-46714271 CTCTAGGGGTTAAAAGAGGAAGG - Intergenic
1127649412 15:60992577-60992599 CTGTAGTGGCAATGAGGAGAAGG - Intronic
1127654328 15:61042031-61042053 GTGTGGTAGTTAAGAGACGAGGG - Intronic
1127907248 15:63384903-63384925 CTGCTGTGGCCAAGAGAAGAGGG - Intergenic
1133668851 16:7997981-7998003 CTGTAGTGGAAAATGGAAGAGGG - Intergenic
1133915828 16:10108674-10108696 CTATAGTGGTTAAGAGACTAGGG - Intronic
1135525281 16:23209400-23209422 CTGGAGGCGTTAAGAGCAGATGG - Intronic
1136049569 16:27640810-27640832 CAGTAGTGCTAAAGGGAAGACGG + Intronic
1136193949 16:28638238-28638260 CTATAGTGGTCAAGAGCATAGGG - Exonic
1136425152 16:30165226-30165248 CGGTAGTGATGAAGAGAAAAGGG + Intergenic
1138158890 16:54734699-54734721 CTGTGGAGGTGAATAGAAGAGGG - Intergenic
1138605179 16:58083987-58084009 CTGCAGTGGCTAAGGGAAGGCGG + Intergenic
1139738856 16:69017529-69017551 CTGTTGTGGTTAAAGGAAGAAGG - Intronic
1141586580 16:85037869-85037891 CTGGAGTGGCCAAGAGCAGAGGG + Intronic
1145929876 17:28677692-28677714 CTGGAGTGGATAAGACAACAGGG - Intronic
1149679922 17:58498975-58498997 CTGTAGTAGTTCAGATATGAGGG - Intronic
1151201361 17:72470131-72470153 CTGTAGTGGGCAAGAAGAGATGG - Intergenic
1152852226 17:82644062-82644084 CTGGAGTGGTTAAAAGAAAGAGG + Intronic
1153205134 18:2691140-2691162 CTGTGGTGGTTAAGACAAGATGG - Intronic
1153389310 18:4535759-4535781 GTGTCAAGGTTAAGAGAAGAAGG + Intergenic
1154178085 18:12101855-12101877 ATCTTGTGATTAAGAGAAGAAGG + Intronic
1155567153 18:27147770-27147792 CTGTAGGGGTTTACAGAGGAAGG - Intronic
1156315913 18:35968520-35968542 CTGTGGTGGTGCAGAGAAGCGGG + Intergenic
1156679691 18:39573376-39573398 TTGTAGTGGCTAACAGCAGATGG - Intergenic
1157161680 18:45319240-45319262 CAGGAGTGGGTAACAGAAGAGGG - Intronic
1158104670 18:53872035-53872057 GTCTAGTGGCTATGAGAAGATGG + Intergenic
1158980295 18:62754054-62754076 CTGAAGTGTTTAAGACAAGCAGG - Intronic
1159678648 18:71318956-71318978 CTGTAGTGATTAAGAGAGTGTGG + Intergenic
1160665258 19:325180-325202 CTCTAGTGGGAAAGAGACGAAGG + Intronic
1162273130 19:9632511-9632533 CTTGAGTAGTTAAGGGAAGAAGG - Intronic
1164756062 19:30690626-30690648 CTCTGGTGGTTCAGAGAGGAGGG + Intronic
1165037104 19:33041597-33041619 CTGTTGTCGTTAAGAGAACAAGG + Intronic
1165583727 19:36893789-36893811 CTGTAGTGGTCTAGGAAAGAGGG - Intronic
925631552 2:5899006-5899028 CAGTTGGGGTTAAGAGAAGTTGG - Intergenic
927272185 2:21223630-21223652 GTGTATTGGTTTAGAGAAAAAGG + Intergenic
929080268 2:38115547-38115569 CTGTACTGGTGAAAAAAAGATGG - Intergenic
930581863 2:53221154-53221176 CCTTAGTGGTTAAGGAAAGAAGG - Intergenic
932097566 2:68865084-68865106 CTGTAGTTGCTCAGAGAGGAGGG - Intergenic
933131611 2:78679387-78679409 CTATAGTGATTAATAGAAAACGG + Intergenic
933391423 2:81673733-81673755 CTGTAGTGGAAAAAATAAGATGG + Intergenic
938818808 2:134932433-134932455 CAGTACTGATTAAGAGAATAAGG - Intronic
940200591 2:151145909-151145931 CTGTAGTAGTTAAAAAAAAAAGG - Intergenic
942490829 2:176488234-176488256 CTGTGGTTGGTATGAGAAGATGG + Intergenic
942518532 2:176778817-176778839 CTGTAGTGATTATTAGAAAAGGG + Intergenic
942997789 2:182285568-182285590 GGGAAGTGGTTAGGAGAAGAAGG - Intronic
944832132 2:203543400-203543422 CAGTAGGAGTTAAGGGAAGAGGG + Intergenic
945157758 2:206857522-206857544 GTGAAGTGGTTAAGATCAGAGGG - Intergenic
1169547710 20:6667644-6667666 CTGGAGTGGTTAAGGTAAGAAGG + Intergenic
1170526896 20:17247766-17247788 CTCTAGTGTTTAAAAGAAGCAGG + Intronic
1170734886 20:19006054-19006076 ATGTACTGATTGAGAGAAGAGGG + Intergenic
1172948123 20:38704023-38704045 GTGTTGTGGCTAAGAGAATAGGG - Intergenic
1173285848 20:41670905-41670927 CTGGAGTGGTAAGGAGAGGAGGG - Intergenic
1175512896 20:59546345-59546367 CTGCACAGGTTAAGAGAATAGGG + Intergenic
1176700341 21:10040332-10040354 CTGTTGTTGTTAAGAAAATAAGG - Intergenic
1176923139 21:14713569-14713591 CAGTAGTGGTTTAGAGACCAAGG + Intergenic
1177102735 21:16916548-16916570 CTGTATTGGTTAAGAAGGGACGG - Intergenic
1177422568 21:20879293-20879315 CTTTAGTGGATCAGAGAAAATGG - Intergenic
1182398381 22:30054394-30054416 CTGTAGTGGTTATGACAATTTGG + Intergenic
1183133401 22:35862417-35862439 CTGTAGTGTTTTAGGGAAGACGG - Intronic
950284020 3:11730834-11730856 ATGTGGTGGTGCAGAGAAGATGG - Intergenic
951470639 3:23052457-23052479 CAGAAGTGGTTCAGAGTAGAAGG - Intergenic
952328267 3:32340283-32340305 CTCTAGTGGATAAGTGAAGATGG + Intronic
953782431 3:45883500-45883522 GTCTGGTGATTAAGAGAAGATGG + Intronic
954946169 3:54426121-54426143 ACATAGTGGTCAAGAGAAGAGGG + Intronic
956501343 3:69888853-69888875 CTGTCTTGGTGAAGAGAAAAGGG + Intronic
957552443 3:81724148-81724170 CTGTACTGGTTCAGTGAACATGG + Intronic
959095908 3:101955456-101955478 ATATAGTTGTTCAGAGAAGAGGG + Intergenic
959104064 3:102046266-102046288 CTATATTAGTTAAGAGAAGGTGG - Intergenic
960144026 3:114180074-114180096 CCATAGTGGTTAAGAGAATTAGG - Intronic
961153452 3:124659062-124659084 CTGAAGTGGTGGAGAGAATAAGG + Intronic
961629252 3:128284305-128284327 CTTTAGTCGTCAAGAAAAGATGG - Intronic
962412523 3:135153796-135153818 CTGTAATGTTTTTGAGAAGAAGG - Intronic
963798955 3:149658205-149658227 CTTTACTGGGTAAGAGGAGACGG + Intronic
964375599 3:156045709-156045731 CTGGAGAGGTTTAGAGAAAAAGG - Intronic
965126032 3:164630754-164630776 TTGTTGTTGTTAAGAGAAAAAGG + Intergenic
965525286 3:169709883-169709905 ATCTTGTGATTAAGAGAAGAAGG - Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
969160839 4:5257632-5257654 CTGTATTGTTTAAGTGAAGTGGG - Intronic
970502900 4:16696312-16696334 CTGTGCTGGTTAAGGGACGATGG - Intronic
970919400 4:21375445-21375467 CTATAGTGGTAAAGATAACATGG + Intronic
971689136 4:29810554-29810576 CTGTAGTAGTTAAGGTAAAAGGG - Intergenic
972708153 4:41566077-41566099 CTTTAGTGGTTAAGAGTTCAGGG - Intronic
974104136 4:57448606-57448628 CTGTGGTGGTTATGAGTTGAAGG - Intergenic
975284701 4:72603668-72603690 CTTTAGTGGTTAAGGGAACTTGG - Intergenic
976134605 4:81922163-81922185 CTGTGGTGGTTAAGAACAGTAGG - Intronic
976261765 4:83152168-83152190 CTGAAGTATTTAAGAGAAAAGGG + Intergenic
978473392 4:109097054-109097076 CTGTAAGGGTTAAAAGCAGAAGG + Intronic
979105134 4:116675863-116675885 CTGAAATGATTAAGAGAGGAAGG + Intergenic
980372754 4:131899111-131899133 CTGTTGTTGTTAAGAAAATAAGG - Intergenic
985180475 4:187256162-187256184 CTGTTGTGAATAAGAGAAAACGG + Intergenic
985331359 4:188840000-188840022 GTGAAGTGGCTAAGAGAATATGG - Intergenic
985836638 5:2276861-2276883 CTGTCGTGTACAAGAGAAGATGG + Intergenic
985873150 5:2574998-2575020 CTGCAGTGGTCAAATGAAGAAGG + Intergenic
986439469 5:7767047-7767069 CTGTAGTGGTTAAGAGAAGAAGG - Intronic
987176733 5:15319381-15319403 CTGAGGTGGCTAAGAAAAGATGG - Intergenic
987569498 5:19638009-19638031 CAGAAGTTGTGAAGAGAAGATGG - Intronic
990717119 5:58649580-58649602 CTGGGGTGGTTAAGAGAATGTGG - Intronic
992185397 5:74239486-74239508 CTGTAGTGGTTAGGGGAAGTGGG - Intergenic
992195722 5:74337027-74337049 TTGTAGTGTTAAAGTGAAGAAGG + Intergenic
992253835 5:74901876-74901898 CTGTAGTGTTTAAGAAAATTTGG + Intergenic
996104850 5:119488343-119488365 GTGCAGTGGTAAAGAGAAGTTGG + Intronic
997594426 5:135096528-135096550 CAGTAGTGGTTGAGAGCACAGGG + Intronic
997609486 5:135205059-135205081 CTGTAAAGGTGAAGAGAAGGCGG - Intronic
997924260 5:138013898-138013920 CTATAGGGGATAAGGGAAGATGG - Intronic
998253958 5:140570964-140570986 CTGGAGTGGATCAGAGGAGATGG - Intronic
1000143190 5:158426608-158426630 GTGCAGTGGTTAAGAGCACAGGG + Intergenic
1000681940 5:164196045-164196067 CTGAAGAGGTAGAGAGAAGATGG - Intergenic
1002655536 5:180743754-180743776 CTGTAGATGCTAAGAGAAGAGGG - Intergenic
1006150433 6:31984050-31984072 CTGTCGTGGCAGAGAGAAGAGGG - Intronic
1006156734 6:32016788-32016810 CTGTCGTGGCAGAGAGAAGAGGG - Intronic
1006701959 6:35982204-35982226 CTGTAGGGGGTAAAAAAAGAAGG + Intronic
1006765612 6:36502737-36502759 GCATAGTGGTTAAGAGAAGCAGG - Intronic
1007092461 6:39192721-39192743 CTGTAGGGGGTAAGCCAAGAAGG - Intronic
1008127609 6:47686507-47686529 TTGTAGTGGATGAGAGAAGGAGG + Intronic
1008913581 6:56762694-56762716 GTGTAGAGGTAAAGAGATGAAGG - Intronic
1010709021 6:79150941-79150963 TTGTAGTTATTCAGAGAAGAGGG + Intergenic
1010781330 6:79948218-79948240 CATTAGTAGTTCAGAGAAGAGGG + Intergenic
1011606280 6:89109538-89109560 ATGTAGTGGCTAAGAGGAAAGGG + Intronic
1012638863 6:101582951-101582973 CTGTACTGTTTGAGAGAACAGGG - Intronic
1012839468 6:104311052-104311074 CTGTAGTGGTGAACTGCAGAGGG + Intergenic
1012986271 6:105879433-105879455 CAGTAGTGGTTACTAGAAGCTGG + Intergenic
1013969929 6:116004666-116004688 CTGGAATGGTAAAGATAAGAGGG - Intronic
1016077872 6:139819034-139819056 TTGTATTGGTTCAGAGATGACGG - Intergenic
1018342003 6:162860846-162860868 ATGTTGAGGGTAAGAGAAGATGG + Intronic
1018596219 6:165483767-165483789 CTGTAGTGGTGACTAGCAGAGGG - Intronic
1020401883 7:7788195-7788217 GTGAAGTGGTTTGGAGAAGAAGG + Intronic
1021799213 7:24287322-24287344 CTGTGGTGGGAAGGAGAAGATGG - Intronic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1024419181 7:49142081-49142103 CTGTTCTGGTCAAGAGAATATGG - Intergenic
1024591910 7:50893709-50893731 CTCAAGTGGTTCAGAAAAGATGG + Intergenic
1025027921 7:55533516-55533538 CTTTCGTGGTTAAAAGCAGATGG - Intronic
1026418955 7:70212668-70212690 CTGAAAGGGGTAAGAGAAGAGGG - Intronic
1026672194 7:72400243-72400265 CAGTAGTGCCCAAGAGAAGAGGG - Intronic
1027603080 7:80263745-80263767 CTGAAGTCATTAAGAGAAAAAGG - Intergenic
1032274484 7:130442058-130442080 CTGAAGTGCCTAAGAGAACAAGG - Intronic
1032519621 7:132534129-132534151 GTGTAGTAGTAAAGAGGAGAGGG + Intronic
1033440235 7:141371857-141371879 CTTTAGTAGTTAAGAAGAGATGG - Intronic
1034392191 7:150795310-150795332 CTATAATGGTTAAGAGTAAAGGG - Intronic
1038013078 8:23490221-23490243 GTGTAGTGGTTAAGAATACATGG - Intergenic
1039918160 8:41875001-41875023 CTGTGGTGGTCCAGAGAGGACGG + Intronic
1044621463 8:94194621-94194643 CTTTATTTGGTAAGAGAAGAGGG - Exonic
1045054000 8:98353626-98353648 CTGAAATGGTTAAGACCAGAAGG - Intergenic
1045392507 8:101729565-101729587 CTGCAGGGGTTATGAGAACAAGG - Intronic
1045469022 8:102494665-102494687 GTCTAGTGGTTAAGAGCACAAGG + Intergenic
1046706193 8:117455015-117455037 CTGTAGAAGTTCACAGAAGAGGG + Intergenic
1047061544 8:121232309-121232331 CTGTACTGGTTTATAGAAGCTGG + Intergenic
1048341949 8:133547053-133547075 CAGCAGTGGTTAAGAGTTGAGGG - Intronic
1050780620 9:9329946-9329968 CTGTCATGGGTAAGAGAAGGTGG + Intronic
1051459956 9:17300786-17300808 CTGGAGTGAATAAGAAAAGAAGG - Intronic
1052035852 9:23679955-23679977 CTGTAATGGTTAATAGTAGGTGG - Intergenic
1052435838 9:28427810-28427832 TTAAAGTGGTTAAGAGGAGATGG - Intronic
1052664216 9:31473561-31473583 CTGGAGTTGTCAAGAGAAAAAGG - Intergenic
1052671016 9:31557393-31557415 CTGTGATGGTCAATAGAAGAGGG + Intergenic
1053637542 9:40027154-40027176 CTGTTGTTGTTAAGAAAATAAGG - Intergenic
1053768539 9:41438085-41438107 CTGTTGTTGTTAAGAAAATAAGG + Intergenic
1054547207 9:66349566-66349588 CTGTTGTTGTTAAGAAAATAAGG + Intergenic
1055362289 9:75505708-75505730 CTCAAGTGTTTAAGAGAATATGG + Intergenic
1055983770 9:82034473-82034495 CTGTTGTGGTCAAGAGATAAAGG - Intergenic
1056562187 9:87740468-87740490 TTGTAGGGGTTTGGAGAAGAAGG + Intergenic
1057092265 9:92268980-92269002 CTGCAGTGCCCAAGAGAAGAAGG - Intronic
1058301777 9:103382379-103382401 CTACAGTGATTAAGAGAATATGG + Intergenic
1202785351 9_KI270719v1_random:10397-10419 CTGTTGTTGTTAAGAAAATAAGG - Intergenic
1186254342 X:7702829-7702851 TAGTAATGGCTAAGAGAAGAGGG - Intergenic
1186791778 X:13006671-13006693 CTTGAGAGGGTAAGAGAAGATGG + Intergenic
1187578706 X:20585792-20585814 ATGTAGGGTTTAAGTGAAGAAGG + Intergenic
1187776139 X:22760175-22760197 CTGGAGTTCTTAAAAGAAGAGGG + Intergenic
1188387206 X:29575700-29575722 CTGTAGTGGTTAATATTAGGTGG - Intronic
1191689578 X:63926067-63926089 GTGTAGGGGTTAATGGAAGAGGG + Intergenic
1192226887 X:69235043-69235065 CTGTAAGGATTGAGAGAAGAAGG + Intergenic
1195237616 X:102917395-102917417 CTGATGTGTTTAAAAGAAGACGG + Intergenic
1195253860 X:103074951-103074973 CTGCAGTCGTTGAGATAAGATGG - Intergenic
1195418848 X:104650845-104650867 CAGTAGTGGTTAAGAGATTGGGG + Intronic
1195989334 X:110667111-110667133 CTCTAGTAGTTAAAAGAAAAAGG - Intergenic
1197810173 X:130434271-130434293 GTGTAGTGATTAAGAGGAGGTGG + Intergenic
1198691377 X:139288544-139288566 ATGTAGTGCTTAAGAAAAGCAGG + Intergenic
1199236248 X:145497859-145497881 GTGATGTGATTAAGAGAAGAAGG + Intergenic
1202094197 Y:21227995-21228017 CTGGAGTGGTTAAGAGAGTGAGG - Intergenic