ID: 986451554

View in Genome Browser
Species Human (GRCh38)
Location 5:7869725-7869747
Sequence CCTGCTACTGCCCCACAATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 180}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986451554_986451567 28 Left 986451554 5:7869725-7869747 CCGGATTGTGGGGCAGTAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 180
Right 986451567 5:7869776-7869798 CCTCAGGATGTGTGTTTCATGGG 0: 1
1: 0
2: 0
3: 16
4: 161
986451554_986451560 0 Left 986451554 5:7869725-7869747 CCGGATTGTGGGGCAGTAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 180
Right 986451560 5:7869748-7869770 GATGAGGGGTTGATTGATCCTGG 0: 1
1: 0
2: 0
3: 10
4: 195
986451554_986451565 27 Left 986451554 5:7869725-7869747 CCGGATTGTGGGGCAGTAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 180
Right 986451565 5:7869775-7869797 CCCTCAGGATGTGTGTTTCATGG 0: 1
1: 0
2: 2
3: 12
4: 172
986451554_986451561 1 Left 986451554 5:7869725-7869747 CCGGATTGTGGGGCAGTAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 180
Right 986451561 5:7869749-7869771 ATGAGGGGTTGATTGATCCTGGG 0: 1
1: 0
2: 0
3: 4
4: 106
986451554_986451562 12 Left 986451554 5:7869725-7869747 CCGGATTGTGGGGCAGTAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 180
Right 986451562 5:7869760-7869782 ATTGATCCTGGGAAGCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986451554 Original CRISPR CCTGCTACTGCCCCACAATC CGG (reversed) Intronic
900694497 1:4001436-4001458 CCTGATACTGTCCCCCAACCTGG + Intergenic
901619083 1:10567535-10567557 CATGCCACTGCCCTCCAATCTGG - Intronic
902393164 1:16117964-16117986 CCTACTACTGCCCCATAAGCTGG - Intergenic
903574723 1:24332151-24332173 CCTGGTACAGCCCCACCACCTGG + Intronic
904704193 1:32378048-32378070 CCTTCTGCTCCCCCACATTCAGG - Exonic
906154012 1:43603556-43603578 CCTCCTGCTGCCCCACCCTCAGG - Intronic
906223607 1:44103251-44103273 CCTGCGGCTGCCCCAGAGTCCGG - Intergenic
906366722 1:45216507-45216529 GTTGCTACTGCCATACAATCAGG + Intronic
907020122 1:51059251-51059273 CCTGCTCCTGGCCCCCACTCTGG + Intergenic
907776240 1:57518610-57518632 CCTGCTTCTGCCCCACATCTGGG + Intronic
910835252 1:91501573-91501595 CATGCTACTGCCCCCCAAAGGGG - Intronic
911497689 1:98650994-98651016 CCTGGTAATGCCCCACCTTCAGG - Intergenic
913242487 1:116841336-116841358 CCTGCTACTGCACTACAGCCTGG - Intergenic
913673162 1:121116921-121116943 CCTGCTGCTGCCCGGCAAGCTGG - Intergenic
914374294 1:147060173-147060195 CCTGCTACTGCACTACAGCCTGG - Intergenic
916472154 1:165134639-165134661 CTTTCCACTGCCCCACAATAAGG - Intergenic
919912398 1:202119520-202119542 CCTGCCACTGCACTCCAATCTGG + Intergenic
921112550 1:212053309-212053331 CATGCTACTGCCCTCTAATCTGG - Intronic
921642984 1:217578270-217578292 CATGCCACTGCCCGTCAATCTGG - Intronic
1066474550 10:35732481-35732503 CATGCTACTGCACCCCAGTCTGG - Intergenic
1067811197 10:49428690-49428712 CCTCCTCGTGCCGCACAATCAGG - Intergenic
1068039721 10:51808557-51808579 CCTGCCACTGCCCTCCAGTCTGG + Intronic
1070422025 10:76246571-76246593 CCTATTACTGTCCCACAGTCAGG - Intronic
1070424066 10:76268348-76268370 CCTGCTTCTCTCCCACATTCAGG + Intronic
1071509725 10:86253914-86253936 CCAGCTACTTCCCCTCCATCTGG + Intronic
1072661695 10:97367253-97367275 CCTGCTCCTGGCCCACACCCTGG + Intronic
1074998479 10:118777884-118777906 CCTGCAACTGTTCCACACTCCGG + Intergenic
1075001703 10:118803375-118803397 CCTGCTACTTTCCCACCAGCTGG - Intergenic
1075216710 10:120542826-120542848 CCATCTTTTGCCCCACAATCAGG - Intronic
1077408648 11:2393544-2393566 CTGGCTCCTGCCCCCCAATCTGG - Intronic
1081244682 11:40750176-40750198 CATGCCACTGCACCCCAATCTGG + Intronic
1083589921 11:63887784-63887806 CCTGCTAAGCCCCCACTATCTGG - Intronic
1084026584 11:66454079-66454101 TCTGCTTCTGCCCCACACCCAGG - Intronic
1084160292 11:67345109-67345131 CCTGCCTCAGCCCCACTATCTGG + Intronic
1084317119 11:68351964-68351986 TCTGCTACAGCCCCTCAAACAGG - Intronic
1086109518 11:83184038-83184060 CCTGCCTCAGCCTCACAATCAGG - Intronic
1090170972 11:124604105-124604127 CCTCCTACTGCTTCAAAATCTGG - Intergenic
1090225212 11:125067021-125067043 CGTGCCACTGCACTACAATCTGG - Intronic
1096237944 12:49942537-49942559 CCTGCTCCTTCCCCAGAACCAGG - Intergenic
1097261961 12:57725441-57725463 CCTGCCCCTTCCCCACAAACTGG - Intronic
1097792089 12:63825620-63825642 CATGCCACTGCCCTCCAATCTGG + Intergenic
1100688330 12:97010873-97010895 TGTGCTCCTGCCCCATAATCTGG - Intergenic
1102666983 12:114582622-114582644 CCTGCTACTGCCCTCCACCCTGG + Intergenic
1105383225 13:19906617-19906639 CATGCCACTGCACCACAGTCTGG - Intergenic
1107799894 13:44095825-44095847 CCTCCTTCTCCCCCACAATCTGG - Intergenic
1109010032 13:56928629-56928651 CATGCCACTGCACCACAGTCAGG + Intergenic
1109904061 13:68814866-68814888 CCTGCTACTGCCCTCCAGCCTGG - Intergenic
1111133502 13:84007168-84007190 CATGCTACTGCCCTCCAACCTGG - Intergenic
1113462673 13:110492896-110492918 CCTGCTAAAGCCCCACAAATAGG - Intronic
1113830887 13:113294935-113294957 CCTGCTGCTGCCCCATGCTCTGG - Intergenic
1118486599 14:66220237-66220259 CCTGCTACTGCACTCCAACCTGG - Intergenic
1119271190 14:73306734-73306756 CCTGTTACTGTCACACAATTTGG + Intronic
1119545590 14:75469331-75469353 CCTGCTTCAGCTCCTCAATCTGG - Exonic
1119848370 14:77847524-77847546 CCTGCTACTGCCCTCCAGCCTGG + Intronic
1121838710 14:97115189-97115211 GCTGCTGCTCCCCCACCATCAGG - Intergenic
1122463096 14:101911838-101911860 CCTGCTACTGCACTCCAGTCTGG + Intronic
1127115771 15:55725550-55725572 CGTGCTACTGCCCTCCAGTCTGG + Intronic
1128251712 15:66168334-66168356 CCAGCTCCTGCCCAACTATCAGG + Intronic
1128998942 15:72317500-72317522 CCTGCCACTGACCCACTCTCTGG - Intronic
1132009384 15:98262033-98262055 CTTACTACTGGCCCACAATGAGG + Intergenic
1135035494 16:19073447-19073469 CTTGCTACTGCACTACAGTCTGG + Intronic
1135602688 16:23796632-23796654 CATGCCACTGCACTACAATCTGG - Intergenic
1138555056 16:57766107-57766129 CCTGTGGCTGCCCCACTATCTGG - Intronic
1139540889 16:67615096-67615118 CATGCTACTGCACTACAACCTGG + Intronic
1140990338 16:80204983-80205005 CTTGCTTCTGCCACCCAATCTGG + Intergenic
1146720204 17:35118784-35118806 CGTGCTACTGCACTCCAATCTGG - Intronic
1147788686 17:42998914-42998936 CTGGCTACTGCCCCAGAAACAGG - Intronic
1148183220 17:45621053-45621075 CCCGCTCCTCCCCCAAAATCCGG + Intergenic
1148265630 17:46224638-46224660 CCCGCTCCTCCCCCAAAATCCGG - Intronic
1148509470 17:48156427-48156449 CCTGCACCAGCGCCACAATCTGG + Intronic
1148586136 17:48782147-48782169 CATGCCACTGCCCCACAGCCTGG - Intronic
1149943691 17:60898904-60898926 CCTGCCACTGCCTCAAAAGCTGG - Intronic
1151636396 17:75351607-75351629 CATGCCACTGCACCCCAATCTGG + Intronic
1154469291 18:14683039-14683061 CATGCCACTGCACCCCAATCTGG - Intergenic
1155501870 18:26494325-26494347 CCTGCTACTGCCCTCCAGCCTGG + Intronic
1157268649 18:46251441-46251463 ACTGCTAGTGCCACATAATCTGG + Intronic
1160925796 19:1544883-1544905 CCTGCTACTGCACTCCAGTCTGG - Intergenic
1161615966 19:5270332-5270354 CATGCTACTGCACCCCAGTCTGG - Intronic
1162612530 19:11767454-11767476 CCGGTTACAGCCGCACAATCTGG - Intronic
1162683732 19:12365225-12365247 CCGGTTACAGCCGCACAATCTGG + Exonic
1163777431 19:19226661-19226683 CCTGCTTCTCCTCCAAAATCAGG - Exonic
1164846725 19:31438791-31438813 CCACCTGCTGCTCCACAATCAGG + Intergenic
1164861397 19:31564874-31564896 CCTGAAACTGACCCACAACCTGG - Intergenic
1165348809 19:35265784-35265806 CCTGCCACTGCATCTCAATCTGG + Intronic
1165493347 19:36138337-36138359 CATGCCACTGCACTACAATCTGG - Intergenic
1166135841 19:40776696-40776718 CATGCTACTGCACCTCAACCTGG + Intronic
1167060326 19:47140749-47140771 CTTGCCACTGCCCTTCAATCTGG + Intronic
1167849216 19:52189395-52189417 CCTGCCACTGCACTACAGTCTGG + Intergenic
1168159278 19:54498265-54498287 CCTGCTACCACCCCACCCTCAGG + Intronic
928235049 2:29531958-29531980 CCAGCTGCTGCCCCACAACGAGG - Exonic
929444125 2:41989436-41989458 AGTGCTGCTGCCCCACAGTCTGG + Intergenic
929839098 2:45437682-45437704 CGTGCCACTGCACTACAATCTGG + Intronic
933737920 2:85510228-85510250 CCTGCTACTGCCCTCCAGCCTGG - Intergenic
934991145 2:98922394-98922416 CCCGCTACTGCACCCCAACCTGG + Intronic
936085720 2:109467548-109467570 CCTGCAGCAGCCCCACCATCTGG - Intronic
937080234 2:119135425-119135447 ACTGCGGCTGCCTCACAATCCGG + Intergenic
939368368 2:141265028-141265050 CCTGCTAATGCACCTCCATCGGG + Intronic
941508499 2:166376422-166376444 CCAGCCACTGCCCCAGACTCAGG - Intergenic
945290687 2:208124392-208124414 CCTGCTCCTGCCCCAGTCTCTGG + Intronic
945892461 2:215444062-215444084 CTTGCCACTGCACTACAATCTGG - Intergenic
945946155 2:215997912-215997934 CCTGCTGCTGAACCCCAATCTGG - Intronic
948504028 2:238415782-238415804 CCTGCCACAGCCCAACAAACAGG + Intergenic
1169459037 20:5778561-5778583 CGTGCTACTGCACCCCAACCTGG + Intronic
1172606509 20:36217694-36217716 CCTGCTGCTGGGCCACATTCTGG + Intronic
1174393497 20:50232516-50232538 CCTGCCACTGCCCAGCACTCTGG - Intergenic
1176419221 21:6500407-6500429 CATGGTCCTGCCCCACAGTCTGG - Intergenic
1178288959 21:31350179-31350201 CCTGCTACTTCCCCACAGTAGGG - Intronic
1179694714 21:43108729-43108751 CATGGTCCTGCCCCACAGTCTGG - Intergenic
1181003552 22:19999081-19999103 CATGCTACAGCCCCACAGCCAGG + Intronic
1182516558 22:30862254-30862276 CCTGCTGCTGCCCTCCAACCTGG - Intronic
1183830136 22:40414297-40414319 CGTGCTACTGCACTCCAATCTGG + Intronic
1184867441 22:47209500-47209522 CCTGCGCCTGCCCCACACTGTGG + Intergenic
950367762 3:12500180-12500202 CCTGCAACTGCTCCAGCATCTGG + Intronic
952226444 3:31381729-31381751 TCTTCTACTGCCTCCCAATCAGG - Intergenic
954292405 3:49656532-49656554 CCAGCTCCTGCCCCACTAGCTGG + Exonic
954806178 3:53222265-53222287 CCTGCCGCTGCCCCACAGCCTGG - Intergenic
955172043 3:56575934-56575956 TATGCTACTGCCTCACCATCAGG + Intronic
957505014 3:81108245-81108267 CCTGCTACTGCACCCCAGCCTGG - Intergenic
957787740 3:84903826-84903848 CGTGCCACTGCCCAACAGTCTGG + Intergenic
958853285 3:99354488-99354510 CCTGCCACTGCCCTCCAACCTGG + Intergenic
961372743 3:126441319-126441341 GCTGCTAGTGCGCCACAAGCAGG + Intronic
961499855 3:127324436-127324458 ACTGGGACTGCCCCAGAATCGGG + Intergenic
962797516 3:138861985-138862007 CCTCCTTCTGCCTCACAATGTGG + Intergenic
966169754 3:177066210-177066232 ACTGCTACTGCCCTACATTGAGG + Intronic
966293846 3:178394107-178394129 CCTGCTACTGTTCCAGAATTTGG - Intergenic
966310043 3:178583896-178583918 CCTGCTACTGCATCACTTTCAGG - Intronic
968650589 4:1758841-1758863 CCTGGGAGTGCCCCACACTCGGG - Intergenic
969276821 4:6141390-6141412 CCTGCTACTGCACCCCAGCCTGG + Intronic
969886169 4:10217476-10217498 CCAGCCACTGCCACAAAATCAGG + Intergenic
969908129 4:10416640-10416662 CCTGTTAGTGCCCCACAAAAGGG - Intergenic
970578136 4:17447618-17447640 TCTGTTACTGCCTCATAATCTGG - Intergenic
974014256 4:56634572-56634594 CCTGCAACAGCCCCAGAAGCAGG + Intergenic
976373354 4:84315740-84315762 CCTCCTGCTGACACACAATCAGG + Intergenic
977191506 4:94006506-94006528 CCAGCTACTGCACTACAAGCTGG + Intergenic
982423663 4:155229757-155229779 CCTATTTCTGCCCCACAAGCTGG - Intergenic
985347802 4:189025223-189025245 CCTGCTCCTTCCCCACTATAAGG + Intergenic
986451554 5:7869725-7869747 CCTGCTACTGCCCCACAATCCGG - Intronic
989185379 5:38620001-38620023 CATGCGACTGCCTCACAATATGG + Intergenic
991653015 5:68875235-68875257 CATGCCACTGCACTACAATCTGG + Intergenic
996029318 5:118687238-118687260 CCAGCTAGTGCCTAACAATCAGG - Intergenic
997391913 5:133524137-133524159 CCTCCTTCTGCCCCTCAAGCAGG - Intronic
999093100 5:148954874-148954896 CCTGCAACTGCCCTACAAATGGG + Intronic
1000546205 5:162606087-162606109 CCTGCCACTGCCCTTCATTCTGG + Intergenic
1001642798 5:173256929-173256951 CCAGCTGCTGCCACCCAATCTGG - Intergenic
1002063685 5:176641720-176641742 CCTGCTCCTCCCCCACACTTGGG - Intronic
1006311725 6:33265781-33265803 CCTACTGCTGACCCACAATCAGG - Intronic
1011040860 6:83029257-83029279 CCTGATATTGTCCCACAAACTGG + Intronic
1011212149 6:84966689-84966711 CATGCTCCTGCCCCACCAGCTGG - Intergenic
1012639120 6:101586844-101586866 CCTGCTACTGCACTATAGTCTGG + Intronic
1015667120 6:135644389-135644411 CATGCCACTGCCCTCCAATCTGG + Intergenic
1016357031 6:143229004-143229026 CCTCCTACTGGCCCCAAATCTGG - Intronic
1020430798 7:8114344-8114366 CCTGCCACTTCACCACAACCAGG + Intronic
1022385098 7:29892151-29892173 CCTAATACTGCCCCAGAATTAGG + Intronic
1023142653 7:37117612-37117634 GCTGTTACTGCCAAACAATCGGG - Intronic
1026071278 7:67122734-67122756 CCTACTACTGGCCAACAAGCAGG - Intronic
1026473810 7:70717073-70717095 CGTGCCACTGCACCACAGTCTGG - Intronic
1026705614 7:72689551-72689573 CCTACTACTGGCCAACAAGCAGG + Intronic
1029881129 7:103811213-103811235 GCTTCTATTGCCCCACAAGCAGG - Intronic
1034182608 7:149149792-149149814 CCTGCCACTGCCCTCCAACCTGG + Intronic
1038659009 8:29480608-29480630 CATGCCACTGCCCTCCAATCTGG + Intergenic
1039900533 8:41748989-41749011 CCTGCCACTGCCCTCCAACCTGG + Intronic
1040581751 8:48704177-48704199 CCTCCCACTGCCCCTCACTCTGG + Intergenic
1045654429 8:104372492-104372514 GCAACTTCTGCCCCACAATCAGG + Intronic
1047238020 8:123059704-123059726 CATGCCACTGCACTACAATCTGG - Intronic
1047915144 8:129574991-129575013 AGTGCTACTGGCCCATAATCAGG - Intergenic
1049018114 8:139935954-139935976 CCTGCTCCAGTCCCACAATGGGG + Intronic
1049658132 8:143807867-143807889 CATGCCACTGGCCCACACTCAGG + Intronic
1053240747 9:36492774-36492796 CGTGCCACTGCACCACAACCTGG + Intergenic
1054783375 9:69186896-69186918 CCTGGAACCTCCCCACAATCAGG + Intronic
1055464844 9:76554333-76554355 CGTGCTACTGCACCACAGCCTGG + Intergenic
1060444272 9:123673501-123673523 CCTGCCTCAGCCCCAGAATCAGG + Intronic
1061129671 9:128701990-128702012 CCTGCCACTGCCCTCCAACCTGG - Intergenic
1061926440 9:133808267-133808289 CCTCCTGCTGCCCCACCCTCTGG - Intronic
1062167946 9:135117711-135117733 GCAGCTGCTGCCCCACAACCTGG + Intronic
1062405791 9:136395611-136395633 CCTGCTGCTGGCCCAGAACCGGG - Exonic
1186090832 X:6047430-6047452 CATGCTACTGCACTCCAATCTGG + Intronic
1189559308 X:42176077-42176099 CCTGCTCCTGCCTCCCAAACTGG - Intergenic
1190381083 X:49840364-49840386 CCTGCCACTGCCCTCCAGTCTGG - Intergenic
1193575038 X:83185998-83186020 CCTGGTAAGGCCCCACATTCAGG - Intergenic
1193583674 X:83294626-83294648 CATGCTACTACCTCCCAATCTGG + Intergenic
1195011244 X:100734032-100734054 CCTGCCACTGCACCCCAACCTGG + Intergenic
1195196773 X:102504741-102504763 CCAACTCCTGCCCCACAACCAGG - Intergenic
1196892741 X:120306725-120306747 CCTGCTCCTTCCCCACCAGCTGG + Intronic
1197891440 X:131274269-131274291 TCTGGTATTGCCCCACACTCTGG + Intronic
1198727634 X:139693165-139693187 CCAGCTACTGCTTCACAAGCAGG - Intronic