ID: 986454971

View in Genome Browser
Species Human (GRCh38)
Location 5:7909059-7909081
Sequence CAGTAGTATGAGAAGGCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986454961_986454971 13 Left 986454961 5:7909023-7909045 CCTATCTCAAATCAGAAGGTTTC No data
Right 986454971 5:7909059-7909081 CAGTAGTATGAGAAGGCTGGGGG No data
986454960_986454971 16 Left 986454960 5:7909020-7909042 CCACCTATCTCAAATCAGAAGGT No data
Right 986454971 5:7909059-7909081 CAGTAGTATGAGAAGGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986454971 Original CRISPR CAGTAGTATGAGAAGGCTGG GGG Intergenic
No off target data available for this crispr