ID: 986456357

View in Genome Browser
Species Human (GRCh38)
Location 5:7924516-7924538
Sequence ACTAATCCAGGAGAGCTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986456357_986456363 7 Left 986456357 5:7924516-7924538 CCTTTGAGCTCTCCTGGATTAGT No data
Right 986456363 5:7924546-7924568 TGCAGGAAATGGGACAACACCGG No data
986456357_986456359 -10 Left 986456357 5:7924516-7924538 CCTTTGAGCTCTCCTGGATTAGT No data
Right 986456359 5:7924529-7924551 CTGGATTAGTCCATCTCTGCAGG No data
986456357_986456361 -3 Left 986456357 5:7924516-7924538 CCTTTGAGCTCTCCTGGATTAGT No data
Right 986456361 5:7924536-7924558 AGTCCATCTCTGCAGGAAATGGG No data
986456357_986456360 -4 Left 986456357 5:7924516-7924538 CCTTTGAGCTCTCCTGGATTAGT No data
Right 986456360 5:7924535-7924557 TAGTCCATCTCTGCAGGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986456357 Original CRISPR ACTAATCCAGGAGAGCTCAA AGG (reversed) Intergenic
No off target data available for this crispr