ID: 986456358

View in Genome Browser
Species Human (GRCh38)
Location 5:7924528-7924550
Sequence CTGCAGAGATGGACTAATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986456358_986456365 20 Left 986456358 5:7924528-7924550 CCTGGATTAGTCCATCTCTGCAG No data
Right 986456365 5:7924571-7924593 TTGATAAAACCAAAGAGCTGAGG No data
986456358_986456363 -5 Left 986456358 5:7924528-7924550 CCTGGATTAGTCCATCTCTGCAG No data
Right 986456363 5:7924546-7924568 TGCAGGAAATGGGACAACACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986456358 Original CRISPR CTGCAGAGATGGACTAATCC AGG (reversed) Intergenic
No off target data available for this crispr