ID: 986456363

View in Genome Browser
Species Human (GRCh38)
Location 5:7924546-7924568
Sequence TGCAGGAAATGGGACAACAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986456358_986456363 -5 Left 986456358 5:7924528-7924550 CCTGGATTAGTCCATCTCTGCAG No data
Right 986456363 5:7924546-7924568 TGCAGGAAATGGGACAACACCGG No data
986456357_986456363 7 Left 986456357 5:7924516-7924538 CCTTTGAGCTCTCCTGGATTAGT No data
Right 986456363 5:7924546-7924568 TGCAGGAAATGGGACAACACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986456363 Original CRISPR TGCAGGAAATGGGACAACAC CGG Intergenic
No off target data available for this crispr