ID: 986465756

View in Genome Browser
Species Human (GRCh38)
Location 5:8021282-8021304
Sequence CTGGAGATTCAGAATGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986465756_986465759 0 Left 986465756 5:8021282-8021304 CCTTGCTCATTCTGAATCTCCAG No data
Right 986465759 5:8021305-8021327 CAATTTGTCAATTATAGTTTGGG No data
986465756_986465758 -1 Left 986465756 5:8021282-8021304 CCTTGCTCATTCTGAATCTCCAG No data
Right 986465758 5:8021304-8021326 GCAATTTGTCAATTATAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986465756 Original CRISPR CTGGAGATTCAGAATGAGCA AGG (reversed) Intergenic
No off target data available for this crispr