ID: 986469657

View in Genome Browser
Species Human (GRCh38)
Location 5:8061091-8061113
Sequence AGAACGGAAGCTGCCTTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986469657_986469662 20 Left 986469657 5:8061091-8061113 CCTGAAAAGGCAGCTTCCGTTCT No data
Right 986469662 5:8061134-8061156 CCTGGCAGCCAACTTAAACAAGG No data
986469657_986469660 2 Left 986469657 5:8061091-8061113 CCTGAAAAGGCAGCTTCCGTTCT No data
Right 986469660 5:8061116-8061138 TGGAGATGAACTGATTTGCCTGG No data
986469657_986469663 23 Left 986469657 5:8061091-8061113 CCTGAAAAGGCAGCTTCCGTTCT No data
Right 986469663 5:8061137-8061159 GGCAGCCAACTTAAACAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986469657 Original CRISPR AGAACGGAAGCTGCCTTTTC AGG (reversed) Intergenic
No off target data available for this crispr