ID: 986470396

View in Genome Browser
Species Human (GRCh38)
Location 5:8067972-8067994
Sequence CATAGGGCACAGTTGCACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986470391_986470396 4 Left 986470391 5:8067945-8067967 CCAGGAGAGAAGGCAGAGAAGCC No data
Right 986470396 5:8067972-8067994 CATAGGGCACAGTTGCACATGGG No data
986470388_986470396 28 Left 986470388 5:8067921-8067943 CCTTGGGACAGTTCATCTGTGGT No data
Right 986470396 5:8067972-8067994 CATAGGGCACAGTTGCACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986470396 Original CRISPR CATAGGGCACAGTTGCACAT GGG Intergenic
No off target data available for this crispr