ID: 986478299

View in Genome Browser
Species Human (GRCh38)
Location 5:8158503-8158525
Sequence CAGGAACCTGCACTTGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986478299_986478307 2 Left 986478299 5:8158503-8158525 CCCCTCCCAAGTGCAGGTTCCTG No data
Right 986478307 5:8158528-8158550 GCCACCAGCGTGGCTATGCAAGG No data
986478299_986478305 -8 Left 986478299 5:8158503-8158525 CCCCTCCCAAGTGCAGGTTCCTG No data
Right 986478305 5:8158518-8158540 GGTTCCTGGAGCCACCAGCGTGG No data
986478299_986478311 5 Left 986478299 5:8158503-8158525 CCCCTCCCAAGTGCAGGTTCCTG No data
Right 986478311 5:8158531-8158553 ACCAGCGTGGCTATGCAAGGGGG No data
986478299_986478309 3 Left 986478299 5:8158503-8158525 CCCCTCCCAAGTGCAGGTTCCTG No data
Right 986478309 5:8158529-8158551 CCACCAGCGTGGCTATGCAAGGG No data
986478299_986478310 4 Left 986478299 5:8158503-8158525 CCCCTCCCAAGTGCAGGTTCCTG No data
Right 986478310 5:8158530-8158552 CACCAGCGTGGCTATGCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986478299 Original CRISPR CAGGAACCTGCACTTGGGAG GGG (reversed) Intergenic
No off target data available for this crispr