ID: 986480705

View in Genome Browser
Species Human (GRCh38)
Location 5:8184181-8184203
Sequence CACCTAGCTTTTGCCTCCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986480703_986480705 -3 Left 986480703 5:8184161-8184183 CCTCTGAAATCTTTGGTTGCCAC No data
Right 986480705 5:8184181-8184203 CACCTAGCTTTTGCCTCCTTAGG No data
986480700_986480705 7 Left 986480700 5:8184151-8184173 CCTGCTTCCTCCTCTGAAATCTT No data
Right 986480705 5:8184181-8184203 CACCTAGCTTTTGCCTCCTTAGG No data
986480702_986480705 0 Left 986480702 5:8184158-8184180 CCTCCTCTGAAATCTTTGGTTGC No data
Right 986480705 5:8184181-8184203 CACCTAGCTTTTGCCTCCTTAGG No data
986480699_986480705 12 Left 986480699 5:8184146-8184168 CCTTACCTGCTTCCTCCTCTGAA No data
Right 986480705 5:8184181-8184203 CACCTAGCTTTTGCCTCCTTAGG No data
986480698_986480705 27 Left 986480698 5:8184131-8184153 CCTGGCAGCTCTGCACCTTACCT No data
Right 986480705 5:8184181-8184203 CACCTAGCTTTTGCCTCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986480705 Original CRISPR CACCTAGCTTTTGCCTCCTT AGG Intergenic
No off target data available for this crispr