ID: 986480764

View in Genome Browser
Species Human (GRCh38)
Location 5:8184685-8184707
Sequence CACTTGGATGAGAGGGCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986480764_986480772 7 Left 986480764 5:8184685-8184707 CCACCAGCCCTCTCATCCAAGTG No data
Right 986480772 5:8184715-8184737 TGGATCTTGCCCATATTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986480764 Original CRISPR CACTTGGATGAGAGGGCTGG TGG (reversed) Intergenic
No off target data available for this crispr