ID: 986481163

View in Genome Browser
Species Human (GRCh38)
Location 5:8189620-8189642
Sequence TCTGCTTTCCAGGCTATGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986481163_986481168 -2 Left 986481163 5:8189620-8189642 CCCTACATAGCCTGGAAAGCAGA No data
Right 986481168 5:8189641-8189663 GAATCCACAAATAGCAAAAGGGG No data
986481163_986481170 26 Left 986481163 5:8189620-8189642 CCCTACATAGCCTGGAAAGCAGA No data
Right 986481170 5:8189669-8189691 TCACAAACGCCAAATATCTGAGG No data
986481163_986481166 -4 Left 986481163 5:8189620-8189642 CCCTACATAGCCTGGAAAGCAGA No data
Right 986481166 5:8189639-8189661 CAGAATCCACAAATAGCAAAAGG No data
986481163_986481171 27 Left 986481163 5:8189620-8189642 CCCTACATAGCCTGGAAAGCAGA No data
Right 986481171 5:8189670-8189692 CACAAACGCCAAATATCTGAGGG No data
986481163_986481167 -3 Left 986481163 5:8189620-8189642 CCCTACATAGCCTGGAAAGCAGA No data
Right 986481167 5:8189640-8189662 AGAATCCACAAATAGCAAAAGGG No data
986481163_986481172 30 Left 986481163 5:8189620-8189642 CCCTACATAGCCTGGAAAGCAGA No data
Right 986481172 5:8189673-8189695 AAACGCCAAATATCTGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986481163 Original CRISPR TCTGCTTTCCAGGCTATGTA GGG (reversed) Intergenic
No off target data available for this crispr