ID: 986481875

View in Genome Browser
Species Human (GRCh38)
Location 5:8197820-8197842
Sequence TCCCTGTAGTGTCCGTGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986481873_986481875 0 Left 986481873 5:8197797-8197819 CCAAAGTTCAATTTCCAAGCTAT No data
Right 986481875 5:8197820-8197842 TCCCTGTAGTGTCCGTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986481875 Original CRISPR TCCCTGTAGTGTCCGTGAGC TGG Intergenic
No off target data available for this crispr