ID: 986482000

View in Genome Browser
Species Human (GRCh38)
Location 5:8198854-8198876
Sequence CTGTATTTCTACAGAGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986481999_986482000 -7 Left 986481999 5:8198838-8198860 CCATCAAGGTCATGCTCTGTATT No data
Right 986482000 5:8198854-8198876 CTGTATTTCTACAGAGAAGATGG No data
986481996_986482000 30 Left 986481996 5:8198801-8198823 CCAGTGGCTCAACATGACTTTCT No data
Right 986482000 5:8198854-8198876 CTGTATTTCTACAGAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986482000 Original CRISPR CTGTATTTCTACAGAGAAGA TGG Intergenic
No off target data available for this crispr