ID: 986482474

View in Genome Browser
Species Human (GRCh38)
Location 5:8202921-8202943
Sequence GAAGCAGCCAAGAGTCTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986482474_986482480 26 Left 986482474 5:8202921-8202943 CCCTACAGACTCTTGGCTGCTTC No data
Right 986482480 5:8202970-8202992 TCTGACCCTCCCTGGTGATGTGG No data
986482474_986482481 30 Left 986482474 5:8202921-8202943 CCCTACAGACTCTTGGCTGCTTC No data
Right 986482481 5:8202974-8202996 ACCCTCCCTGGTGATGTGGCTGG No data
986482474_986482478 18 Left 986482474 5:8202921-8202943 CCCTACAGACTCTTGGCTGCTTC No data
Right 986482478 5:8202962-8202984 TCCTTTGCTCTGACCCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986482474 Original CRISPR GAAGCAGCCAAGAGTCTGTA GGG (reversed) Intergenic
No off target data available for this crispr