ID: 986486260

View in Genome Browser
Species Human (GRCh38)
Location 5:8241521-8241543
Sequence TGTTCCATGCATATGTTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986486260_986486262 14 Left 986486260 5:8241521-8241543 CCATGCAACATATGCATGGAACA No data
Right 986486262 5:8241558-8241580 CATACCAATGGTCTACCACCAGG No data
986486260_986486261 2 Left 986486260 5:8241521-8241543 CCATGCAACATATGCATGGAACA No data
Right 986486261 5:8241546-8241568 ATATTCACAAATCATACCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986486260 Original CRISPR TGTTCCATGCATATGTTGCA TGG (reversed) Intergenic
No off target data available for this crispr