ID: 986488533

View in Genome Browser
Species Human (GRCh38)
Location 5:8265695-8265717
Sequence GCGGGTGAACCATCTGATGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986488533_986488540 7 Left 986488533 5:8265695-8265717 CCGACATCAGATGGTTCACCCGC No data
Right 986488540 5:8265725-8265747 TCCCAAAGTGCTGGGATTACAGG 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
986488533_986488536 -2 Left 986488533 5:8265695-8265717 CCGACATCAGATGGTTCACCCGC No data
Right 986488536 5:8265716-8265738 GCCTCAGCCTCCCAAAGTGCTGG 0: 56931
1: 168651
2: 218048
3: 269456
4: 306914
986488533_986488538 -1 Left 986488533 5:8265695-8265717 CCGACATCAGATGGTTCACCCGC No data
Right 986488538 5:8265717-8265739 CCTCAGCCTCCCAAAGTGCTGGG 0: 90349
1: 212695
2: 235979
3: 260133
4: 296590

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986488533 Original CRISPR GCGGGTGAACCATCTGATGT CGG (reversed) Intergenic
No off target data available for this crispr