ID: 986488536

View in Genome Browser
Species Human (GRCh38)
Location 5:8265716-8265738
Sequence GCCTCAGCCTCCCAAAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1020000
Summary {0: 56931, 1: 168651, 2: 218048, 3: 269456, 4: 306914}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986488532_986488536 -1 Left 986488532 5:8265694-8265716 CCCGACATCAGATGGTTCACCCG No data
Right 986488536 5:8265716-8265738 GCCTCAGCCTCCCAAAGTGCTGG 0: 56931
1: 168651
2: 218048
3: 269456
4: 306914
986488530_986488536 17 Left 986488530 5:8265676-8265698 CCAGGCTGGTCTCAAACTCCCGA 0: 1131
1: 47293
2: 122314
3: 180501
4: 202586
Right 986488536 5:8265716-8265738 GCCTCAGCCTCCCAAAGTGCTGG 0: 56931
1: 168651
2: 218048
3: 269456
4: 306914
986488529_986488536 26 Left 986488529 5:8265667-8265689 CCATGTTGGCCAGGCTGGTCTCA 0: 33771
1: 103275
2: 170461
3: 185790
4: 105028
Right 986488536 5:8265716-8265738 GCCTCAGCCTCCCAAAGTGCTGG 0: 56931
1: 168651
2: 218048
3: 269456
4: 306914
986488533_986488536 -2 Left 986488533 5:8265695-8265717 CCGACATCAGATGGTTCACCCGC No data
Right 986488536 5:8265716-8265738 GCCTCAGCCTCCCAAAGTGCTGG 0: 56931
1: 168651
2: 218048
3: 269456
4: 306914

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986488536 Original CRISPR GCCTCAGCCTCCCAAAGTGC TGG Intergenic
Too many off-targets to display for this crispr