ID: 986488538

View in Genome Browser
Species Human (GRCh38)
Location 5:8265717-8265739
Sequence CCTCAGCCTCCCAAAGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1095746
Summary {0: 90349, 1: 212695, 2: 235979, 3: 260133, 4: 296590}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986488529_986488538 27 Left 986488529 5:8265667-8265689 CCATGTTGGCCAGGCTGGTCTCA 0: 33771
1: 103275
2: 170461
3: 185790
4: 105028
Right 986488538 5:8265717-8265739 CCTCAGCCTCCCAAAGTGCTGGG 0: 90349
1: 212695
2: 235979
3: 260133
4: 296590
986488533_986488538 -1 Left 986488533 5:8265695-8265717 CCGACATCAGATGGTTCACCCGC No data
Right 986488538 5:8265717-8265739 CCTCAGCCTCCCAAAGTGCTGGG 0: 90349
1: 212695
2: 235979
3: 260133
4: 296590
986488530_986488538 18 Left 986488530 5:8265676-8265698 CCAGGCTGGTCTCAAACTCCCGA 0: 1131
1: 47293
2: 122314
3: 180501
4: 202586
Right 986488538 5:8265717-8265739 CCTCAGCCTCCCAAAGTGCTGGG 0: 90349
1: 212695
2: 235979
3: 260133
4: 296590
986488532_986488538 0 Left 986488532 5:8265694-8265716 CCCGACATCAGATGGTTCACCCG No data
Right 986488538 5:8265717-8265739 CCTCAGCCTCCCAAAGTGCTGGG 0: 90349
1: 212695
2: 235979
3: 260133
4: 296590

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986488538 Original CRISPR CCTCAGCCTCCCAAAGTGCT GGG Intergenic
Too many off-targets to display for this crispr